Skip to content

Instantly share code, notes, and snippets.

Embed
What would you like to do?
Perl script to reformat a fasta file so that each sequence line has just 60 characters (amino acids or bases) per line.
#!/usr/local/bin/perl
=head1 NAME
reformat_fasta.pl
=head1 SYNOPSIS
reformat_fasta.pl input_fasta output_fasta outputdir
where input_fasta is the input fasta file,
output_fasta is the output fasta file,
outputdir is the output directory for writing output files.
=head1 DESCRIPTION
This script takes an input fasta file (<input_fasta>), and writes it out
to a new file (<output_fasta>) that has 60 letters (bases/amino acids) per line.
=head1 VERSION
Perl script last edited 8-Feb-2013.
=head1 CONTACT
alc@sanger.ac.uk (Avril Coghlan)
=cut
#
# Perl script reformat_fasta.pl
# Written by Avril Coghlan (alc@sanger.ac.uk)
# 8-Feb-13.
# Last edited 8-Feb-2013.
# SCRIPT SYNOPSIS: reformat_fasta: rewrite a fasta file so that there are 60 characters per line of sequence.
#
#------------------------------------------------------------------#
# CHECK IF THERE ARE THE CORRECT NUMBER OF COMMAND-LINE ARGUMENTS:
use strict;
use warnings;
my $num_args = $#ARGV + 1;
if ($num_args != 3)
{
print "Usage of reformat_fasta.pl\n\n";
print "perl reformat_fasta.pl <input_fasta> <output_fasta> <outputdir>\n";
print "where <input_fasta> is the input fasta file,\n";
print " <output_fasta> is the output fasta file,\n";
print " <outputdir> is the output directory for writing output files\n";
print "For example, >perl reformat_fasta.pl contigs.fa new_contigs.fa\n";
print "/lustre/scratch108/parasites/alc/StrongyloidesCNVnator/sven7Feb2013\n";
exit;
}
# FIND THE PATH TO THE INPUT FASTA FILE:
my $input_fasta = $ARGV[0];
# FIND THE PATH TO THE OUTPUT FASTA FILE:
my $output_fasta = $ARGV[1];
# FIND THE DIRECTORY TO USE FOR OUTPUT FILES:
my $outputdir = $ARGV[2];
#------------------------------------------------------------------#
# TEST SUBROUTINES:
my $PRINT_TEST_DATA = 0; # SAYS WHETHER TO PRINT DATA USED DURING TESTING.
&test_print_seq($outputdir);
&test_print_error;
&test_read_assembly($outputdir);
&test_reformat_fasta($outputdir);
#------------------------------------------------------------------#
# RUN THE MAIN PART OF THE CODE:
&run_main_program($outputdir,$input_fasta,$output_fasta);
print STDERR "FINISHED.\n";
#------------------------------------------------------------------#
# RUN THE MAIN PART OF THE CODE:
sub run_main_program
{
my $outputdir = $_[0]; # DIRECTORY TO PUT OUTPUT FILES IN.
my $input_fasta = $_[1]; # THE INPUT FASTA FILE
my $output_fasta = $_[2]; # THE OUTPUT FASTA FILE
my $errorcode; # RETURNED AS 0 IF THERE IS NO ERROR.
my $errormsg; # RETURNED AS 'none' IF THERE IS NO ERROR.
# READ IN THE INPUT FASTA FILE, AND MAKE THE OUTPUT FASTA FILE:
($errorcode,$errormsg) = &reformat_fasta($outputdir,$input_fasta,$output_fasta);
if ($errorcode != 0) { ($errorcode,$errormsg) = &print_error($errormsg,$errorcode,0); }
}
#------------------------------------------------------------------#
# TEST &reformat_fasta
sub test_reformat_fasta
{
my $outputdir = $_[0]; # DIRECTORY TO PUT OUTPUT FILES INTO
my $input_fasta; # INPUT FASTA FILE
my $output_fasta; # OUTPUT FASTA FILE
my $errormsg; # RETURNED AS 'none' FROM A FUNCTION IF THERE IS NO ERROR
my $errorcode; # RETURNED AS 0 FROM A FUNCTION IF THERE IS NO ERROR
my $expected_output_fasta; # FILE WITH EXPECTED CONTENTS OF $output_fasta
my $differences; # DIFFERENCES BETWEEN $output_fasta AND $expected_output_fasta
my $length_differences; # LENGTH OF $differences
my $line; #
($input_fasta,$errorcode,$errormsg) = &make_filename($outputdir);
if ($errorcode != 0) { ($errorcode,$errormsg) = &print_error($errormsg,$errorcode,0); }
open(INPUT_FASTA,">$input_fasta") || die "ERROR: test_reformat_fasta: cannot open $input_fasta\n";
print INPUT_FASTA ">seq1\n";
print INPUT_FASTA "AAAAAAAAAATTTTTTTTTTAAAAAAAAAATTTTTTTTTTAAAAAAAAAATTTTTTTTTTAAAAAAAAAATTTTTTTTTTAAAAAAAAAATTTTTTTTTT\n";
print INPUT_FASTA ">seq2\n";
print INPUT_FASTA "CCCCCCCCCCGGGGGGGGGGCCCCCCCCCCGGGGGGGGGGCCCCCCCCCCGGGGGGGGGGCCCCCCCCCCGGGGGGGGGGCCCCCCCCCCGGGGGGGGGG\n";
close(INPUT_FASTA);
($output_fasta,$errorcode,$errormsg) = &make_filename($outputdir);
if ($errorcode != 0) { ($errorcode,$errormsg) = &print_error($errormsg,$errorcode,0); }
open(OUTPUT_FASTA,">$output_fasta") || die "ERROR: test_print_seq: cannot open $output_fasta\n";
close(OUTPUT_FASTA);
($errorcode,$errormsg) = &reformat_fasta($outputdir,$input_fasta,$output_fasta);
if ($errorcode != 0) { print STDERR "ERROR: test_reformat_fasta: failed test1\n"; exit;}
($expected_output_fasta,$errorcode,$errormsg) = &make_filename($outputdir);
if ($errorcode != 0) { ($errorcode,$errormsg) = &print_error($errormsg,$errorcode,0); }
open(EXPECTED,">$expected_output_fasta") || die "ERROR: test_reformat_fasta: cannot open $expected_output_fasta\n";
print EXPECTED ">seq1\n";
print EXPECTED "AAAAAAAAAATTTTTTTTTTAAAAAAAAAATTTTTTTTTTAAAAAAAAAATTTTTTTTTT\n";
print EXPECTED "AAAAAAAAAATTTTTTTTTTAAAAAAAAAATTTTTTTTTT\n";
print EXPECTED ">seq2\n";
print EXPECTED "CCCCCCCCCCGGGGGGGGGGCCCCCCCCCCGGGGGGGGGGCCCCCCCCCCGGGGGGGGGG\n";
print EXPECTED "CCCCCCCCCCGGGGGGGGGGCCCCCCCCCCGGGGGGGGGG\n";
close(EXPECTED);
$differences = "";
open(TEMP,"diff $output_fasta $expected_output_fasta |");
while(<TEMP>)
{
$line = $_;
$differences = $differences.$line;
}
close(TEMP);
$length_differences = length($differences);
if ($length_differences != 0) { print STDERR "ERROR: test_reformat_fasta: failed test1 (output_fasta $output_fasta expected_output_fasta $expected_output_fasta)\n"; exit;}
system "rm -f $output_fasta";
system "rm -f $expected_output_fasta";
system "rm -f $input_fasta";
}
#------------------------------------------------------------------#
# READ IN THE INPUT FASTA FILE, AND MAKE THE OUTPUT FASTA FILE:
sub reformat_fasta
{
my $outputdir = $_[0]; # DIRECTORY TO PUT OUTPUT FILES INTO
my $input_fasta = $_[1]; # INPUT FASTA FILE
my $output_fasta = $_[2]; # OUTPUT FASTA FILE
my $errorcode = 0; # RETURNED AS 0 IF THERE IS NO ERROR
my $errormsg = "none";# RETURNED AS 'none' IF THERE IS NO ERROR
my $SEQ; # HASH TABLE TO STORE THE SEQUENCES OF SCAFFOLDS/CHROMOSOMES
my $name; # NAME OF A SCAFFOLD/CHROMOSOME
my $seq; # SEQUENCE OF A SCAFFOLD/CHROMOSOME
# READ IN THE SEQUENCES OF THE SCAFFOLDS/CHROMOSOMES:
($SEQ,$errorcode,$errormsg) = &read_assembly($input_fasta);
if ($errorcode != 0) { ($errorcode,$errormsg) = &print_error($errormsg,$errorcode,0); }
# WRITE OUT EACH OF THE SEQUENCES TO THE OUTPUT FILE:
open(OUTPUT_FASTA,">$output_fasta") || die "ERROR: write_new_fasta: cannot open $output_fasta\n";
close(OUTPUT_FASTA);
foreach $name (keys %{$SEQ})
{
if (!($SEQ->{$name}))
{
$errormsg = "ERROR: reformat_fasta: do not know sequence for $name\n";
$errorcode = 1; # ERRORCODE=1 (SHOULDN'T HAPPEN, CAN'T TEST FOR)
return($errorcode,$errormsg);
}
# PRINT OUT THE SEQUENCE:
$seq = $SEQ->{$name};
($errorcode,$errormsg) = &print_seq($output_fasta,$seq,$name);
if ($errorcode != 0) { ($errorcode,$errormsg) = &print_error($errormsg,$errorcode); }
}
return($errorcode,$errormsg);
}
#------------------------------------------------------------------#
# TEST &read_assembly
sub test_read_assembly
{
my $outputdir = $_[0]; # DIRECTORY WHERE WE CAN WRITE OUTPUT FILES
my $assembly; # TEMPORARY ASSEMBLY FILE NAME
my $SEQ; # HASH TABLE WITH SEQUENCES OF SCAFFOLDS
my $errorcode; # RETURNED AS 0 FROM A FUNCTION IF THERE IS NO ERROR
my $errormsg; # RETURNED AS 'none' FROM A FUNCTION IF THERE IS NO ERROR
($assembly,$errorcode,$errormsg) = &make_filename($outputdir);
if ($errorcode != 0) { ($errorcode,$errormsg) = &print_error($errormsg,$errorcode,0); }
open(ASSEMBLY,">$assembly") || die "ERROR: test_read_assembly: cannot open $assembly\n";
print ASSEMBLY ">seq1\n";
print ASSEMBLY "AAAAA\n";
print ASSEMBLY ">seq2\n";
print ASSEMBLY "AAAAATTTTT\n";
print ASSEMBLY "\n";
print ASSEMBLY ">seq3\n";
print ASSEMBLY "AAAAA\n";
print ASSEMBLY "TTTTT\n";
print ASSEMBLY ">seq4\n";
print ASSEMBLY ">seq5\n";
print ASSEMBLY " AAA AA \n";
close(ASSEMBLY);
($SEQ,$errorcode,$errormsg) = &read_assembly($assembly);
if ($SEQ->{'seq1'} ne 'AAAAA' || $SEQ->{'seq2'} ne 'AAAAATTTTT' || $SEQ->{'seq3'} ne 'AAAAATTTTT' || defined($SEQ->{'seq4'}) ||
$SEQ->{'seq5'} ne 'AAAAA' || $errorcode != 0)
{
print STDERR "ERROR: test_read_assembly: failed test1\n";
exit;
}
system "rm -f $assembly";
# TEST ERRORCODE=4:
($assembly,$errorcode,$errormsg) = &make_filename($outputdir);
if ($errorcode != 0) { ($errorcode,$errormsg) = &print_error($errormsg,$errorcode,0); }
open(ASSEMBLY,">$assembly") || die "ERROR: test_assembly: cannot open $assembly\n";
print ASSEMBLY ">seq1\n";
print ASSEMBLY "AAAAA\n";
print ASSEMBLY ">seq2\n";
print ASSEMBLY "AAAAATTTTT\n";
print ASSEMBLY ">seq1\n";
print ASSEMBLY "AAAAA\n";
close(ASSEMBLY);
($SEQ,$errorcode,$errormsg) = &read_assembly($assembly);
if ($errorcode != 4) { print STDERR "ERROR: test_assembly: failed test2\n"; exit;}
system "rm -f $assembly";
# TEST FOR ERRORCODE=5:
($assembly,$errorcode,$errormsg) = &make_filename($outputdir);
if ($errorcode != 0) { ($errorcode,$errormsg) = &print_error($errormsg,$errorcode,0); }
open(ASSEMBLY,">$assembly") || die "ERROR: test_assembly: cannot open $assembly\n";
print ASSEMBLY "AAAAA\n";
print ASSEMBLY ">seq2\n";
print ASSEMBLY "AAAAATTTTT\n";
print ASSEMBLY ">seq1\n";
print ASSEMBLY "AAAAA\n";
close(ASSEMBLY);
($SEQ,$errorcode,$errormsg) = &read_assembly($assembly);
if ($errorcode != 5) { print STDERR "ERROR: test_assembly: failed test2\n"; exit;}
system "rm -f $assembly";
}
#------------------------------------------------------------------#
# READ IN THE ASSEMBLY FILE:
# SUBROUTINE SYNOPSIS: read_assembly(): read fasta file of scaffold sequences into a hash
sub read_assembly
{
my $input_assembly = $_[0]; # THE INPUT ASSEMBLY FILE
my $errorcode = 0; # RETURNED AS 0 IF THERE IS NO ERROR
my $errormsg = "none";# RETURNED AS 'none' IF THERE IS NO ERROR
my $line; #
my $scaffold = "none";# NAME OF SCAFFOLD
my @temp; #
my $seq; # SEQUENCE OF SCAFFOLD
my %SEQ = (); # HASH TABLE FOR STORING SCAFFOLD SEQUENCE
$seq = "";
open(ASSEMBLY,"$input_assembly") || die "ERROR: read_assembly: cannot open $input_assembly\n";
while(<ASSEMBLY>)
{
$line = $_;
chomp $line;
if (substr($line,0,1) eq '>')
{
if ($seq ne "")
{
if ($scaffold eq 'none')
{
$errormsg = "ERROR: read_assembly: do not know name of scaffold\n";
$errorcode = 5; # ERRORCODE=5 (TESTED FOR)
return(\%SEQ,$errorcode,$errormsg);
}
if ($SEQ{$scaffold})
{
$errormsg = "ERROR: read_assembly: already know sequence for scaffold $scaffold\n";
$errorcode = 4; # ERRORCODE=4 (TESTED FOR)
return(\%SEQ,$errorcode,$errormsg);
}
$SEQ{$scaffold}= $seq;
$seq = "";
}
@temp = split(/\s+/,$line);
$scaffold = $temp[0];
$scaffold = substr($scaffold,1,length($scaffold)-1);
}
else
{
$line =~ s/\s+//g; # REMOVE SPACES
$seq = $seq.$line;
}
}
close(ASSEMBLY);
if ($seq ne "")
{
if ($scaffold eq 'none')
{
$errormsg = "ERROR: read_assembly: do not know name of scaffold\n";
$errorcode = 5; # ERRORCODE=5 (TESTED FOR)
return(\%SEQ,$errorcode,$errormsg);
}
if ($SEQ{$scaffold})
{
$errormsg = "ERROR: read_assembly: already know sequence for scaffold $scaffold\n";
$errorcode = 4; # ERRORCODE=4 (TESTED FOR)
return(\%SEQ,$errorcode,$errormsg);
}
$SEQ{$scaffold} = $seq;
$seq = "";
}
return(\%SEQ,$errorcode,$errormsg);
}
#------------------------------------------------------------------#
# PRINT OUT THE SEQUENCE:
# SUBROUTINE SYNOPSIS: print_seq(): print out a fasta sequence to an output file, putting 60 characters per line
sub print_seq
{
my $output_fasta = $_[0]; # THE OUTPUT FASTA FILE
my $seq = $_[1]; # THE SEQUENCE TO PRINT OUT
my $scaffold = $_[2]; # SCAFFOLD NAME
my $errorcode = 0; # RETURNED AS 0 IF THERE IS NO ERROR
my $errormsg = "none";# RETURNED AS 'none' IF THERE IS NO ERROR
my $length; # LENGTH OF SEQUENCE $seq
my $offset; #
my $a_line; # A LINE OF THE SEQUENCE
$length = length($seq);
$offset = 0;
open(FASTA,">>$output_fasta") || die "ERROR: write_new_fasta: cannot open $output_fasta\n";
print FASTA ">$scaffold\n";
while($offset < $length)
{
$a_line = substr($seq,$offset,60);
print FASTA "$a_line\n";
$offset = $offset + 60;
}
close(FASTA);
return($errorcode,$errormsg);
}
#------------------------------------------------------------------#
# TEST &print_seq
sub test_print_seq
{
my $outputdir = $_[0]; # DIRECTORY TO WRITE OUTPUT FILES IN
my $output_fasta; # OUTPUT FILE
my $seq; # SEQUENCE
my $errorcode; # RETURNED AS 0 BY A FUNCTION IF THERE IS NO ERROR
my $errormsg; # RETURNED AS 'none' BY A FUNCTION IF THERE IS NO ERROR
my $expected_output_fasta; # FILE CONTAINING EXPECTED CONTENTS OF $output_fasta
my $differences; # DIFFERENCES BETWEEN $output_fasta AND $expected_output_fasta
my $line; #
my $length_differences; # LENGTH OF $differences
($output_fasta,$errorcode,$errormsg) = &make_filename($outputdir);
if ($errorcode != 0) { ($errorcode,$errormsg) = &print_error($errormsg,$errorcode,0); }
$seq = "AAAAATTTTTCCCCCGGGGGAAAAATTTTTCCCCCGGGGGAAAAATTTTTCCCCCGGGGGAAAAATTTTTCCCCCGGGGGAAAAATTTTTCCCCCGGGGGAAAAATTTTTCCCCCGGGGGAAAAATTTTTCCCCCGGGGG";
open(OUTPUT_FASTA,">$output_fasta") || die "ERROR: test_print_seq: cannot open $output_fasta\n";
close(OUTPUT_FASTA);
($errorcode,$errormsg) = &print_seq($output_fasta,$seq,"seq1");
if ($errorcode != 0) { print STDERR "ERROR: test_print_seq: failed test1\n"; exit;}
($expected_output_fasta,$errorcode,$errormsg) = &make_filename($outputdir);
if ($errorcode != 0) { ($errorcode,$errormsg) = &print_error($errormsg,$errorcode,0); }
open(EXPECTED_OUTPUT,">$expected_output_fasta") || die "ERROR: test_print_to_output: cannot open $expected_output_fasta\n";
print EXPECTED_OUTPUT ">seq1\n";
print EXPECTED_OUTPUT "AAAAATTTTTCCCCCGGGGGAAAAATTTTTCCCCCGGGGGAAAAATTTTTCCCCCGGGGG\n";
print EXPECTED_OUTPUT "AAAAATTTTTCCCCCGGGGGAAAAATTTTTCCCCCGGGGGAAAAATTTTTCCCCCGGGGG\n";
print EXPECTED_OUTPUT "AAAAATTTTTCCCCCGGGGG\n";
close(EXPECTED_OUTPUT);
$differences = "";
open(TEMP,"diff $output_fasta $expected_output_fasta |");
while(<TEMP>)
{
$line = $_;
$differences = $differences.$line;
}
close(TEMP);
$length_differences = length($differences);
if ($length_differences != 0) { print STDERR "ERROR: test_print_seq: failed test1 (output_fasta $output_fasta expected_output_fasta $expected_output_fasta)\n"; exit;}
system "rm -f $output_fasta";
system "rm -f $expected_output_fasta";
}
#------------------------------------------------------------------#
# SUBROUTINE TO MAKE A FILE NAME FOR A TEMPORARY FILE:
sub make_filename
{
my $outputdir = $_[0]; # OUTPUT DIRECTORY TO WRITE TEMPORARY FILE NAME TO
my $found_name = 0; # SAYS WHETHER WE HAVE FOUND A FILE NAME YET
my $filename = "none";# NEW FILE NAME TO USE
my $errorcode = 0; # RETURNED AS 0 IF THERE IS NO ERROR
my $errormsg = "none";# RETURNED AS 'none' IF THERE IS NO ERROR
my $poss_filename; # POSSIBLE FILE NAME TO USE
my $random_number; # RANDOM NUMBER TO USE IN TEMPORARY FILE NAME
while($found_name == 0)
{
$random_number = rand();
$poss_filename = $outputdir."/tmp".$random_number;
if (!(-e $poss_filename))
{
$filename = $poss_filename;
$found_name = 1;
}
}
if ($found_name == 0 || $filename eq 'none')
{
$errormsg = "ERROR: make_filename: found_name $found_name filename $filename\n";
$errorcode = 6; # ERRORCODE=6
return($filename,$errorcode,$errormsg);
}
return($filename,$errorcode,$errormsg);
}
#------------------------------------------------------------------#
# TEST &print_error
sub test_print_error
{
my $errormsg; # RETURNED AS 'none' FROM A FUNCTION IF THERE WAS NO ERROR
my $errorcode; # RETURNED AS 0 FROM A FUNCTION IF THERE WAS NO ERROR
($errormsg,$errorcode) = &print_error(45,45,1);
if ($errorcode != 12) { print STDERR "ERROR: test_print_error: failed test1\n"; exit;}
($errormsg,$errorcode) = &print_error('My error message','My error message',1);
if ($errorcode != 11) { print STDERR "ERROR: test_print_error: failed test2\n"; exit;}
($errormsg,$errorcode) = &print_error('none',45,1);
if ($errorcode != 13) { print STDERR "ERROR: test_print_error: failed test3\n"; exit;}
($errormsg,$errorcode) = &print_error('My error message', 0, 1);
if ($errorcode != 13) { print STDERR "ERROR: test_print_error: failed test4\n"; exit;}
}
#------------------------------------------------------------------#
# PRINT OUT AN ERROR MESSAGE AND EXIT.
sub print_error
{
my $errormsg = $_[0]; # THIS SHOULD BE NOT 'none' IF AN ERROR OCCURRED.
my $errorcode = $_[1]; # THIS SHOULD NOT BE 0 IF AN ERROR OCCURRED.
my $called_from_test = $_[2]; # SAYS WHETHER THIS WAS CALLED FROM test_print_error OR NOT
if ($errorcode =~ /[A-Z]/ || $errorcode =~ /[a-z]/)
{
if ($called_from_test == 1)
{
$errorcode = 11; $errormsg = "ERROR: print_error: the errorcode is $errorcode, should be a number.\n"; # ERRORCODE=11
return($errormsg,$errorcode);
}
else
{
print STDERR "ERROR: print_error: the errorcode is $errorcode, should be a number.\n";
exit;
}
}
if (!($errormsg =~ /[A-Z]/ || $errormsg =~ /[a-z]/))
{
if ($called_from_test == 1)
{
$errorcode = 12; $errormsg = "ERROR: print_error: the errormessage $errormsg does not seem to contain text.\n"; # ERRORCODE=12
return($errormsg,$errorcode);
}
else
{
print STDERR "ERROR: print_error: the errormessage $errormsg does not seem to contain text.\n";
exit;
}
}
if ($errormsg eq 'none' || $errorcode == 0)
{
if ($called_from_test == 1)
{
$errorcode = 13; $errormsg = "ERROR: print_error: errormsg $errormsg, errorcode $errorcode.\n"; # ERRORCODE=13
return($errormsg,$errorcode);
}
else
{
print STDERR "ERROR: print_error: errormsg $errormsg, errorcode $errorcode.\n";
exit;
}
}
else
{
print STDERR "$errormsg";
exit;
}
return($errormsg,$errorcode);
}
#------------------------------------------------------------------#
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment