Last active
October 22, 2020 01:43
-
-
Save avrilcoghlan/6308594 to your computer and use it in GitHub Desktop.
Python module to carry out simple bioinformatics analyses
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| import os | |
| import sys | |
| from Bio import Entrez | |
| from Bio import SeqIO | |
| import matplotlib.pyplot as plt | |
| #====================================================================# | |
| # Checked and seems to work fine. | |
| # Takes the GenBank accession number (GI number) as input. | |
| # First checks to see if the sequence has been stored locally as a file. | |
| # If it hasn't, the sequence is downloaded and stored locally as a file. | |
| def getgenbank(accession): | |
| """Gets a sequence for a particular accession (GI number) from GenBank, and | |
| saves it in a file gi_<accession> | |
| >>> getgenbank("226880621") | |
| Parsing filename gi_226880621... | |
| SeqRecord(seq=Seq('CGGAAAGATGATGGAACGTT', SingleLetterAlphabet()), id='gi|226880621|emb|GN082338.1|', name='gi|226880621|emb|GN082338.1|', description='gi|226880621|emb|GN082338.1| Sequence 6 from Patent WO2009030679', dbxrefs=[]) | |
| """ | |
| Entrez.email = "alc@sanger.ac.uk" | |
| filename = "gi_%s"% accession | |
| if not os.path.isfile(filename): | |
| print("Downloading %s..." % filename) | |
| net_handle = Entrez.efetch(db="nucleotide", id=accession, rettype="fasta") | |
| out_handle = open(filename, "w") | |
| out_handle.write(net_handle.read()) | |
| out_handle.close() | |
| net_handle.close() | |
| print("Saved %s" % filename) | |
| print("Parsing filename %s..." % filename) | |
| record = SeqIO.read(open(filename),"fasta") | |
| return record | |
| #====================================================================# | |
| # Agrees with output from Matlab at http://www.computational-genomics.net/case_studies/haemophilus_demo.html | |
| # Checked and seems to work fine. | |
| def basecount(seq,useall=False,calcfreqs=False,verbose=False): | |
| """Prints out the number or frequency of each symbol in a DNA sequence | |
| # Followed ideas at http://bugs.python.org/issue3332 and | |
| # http://stackoverflow.com/questions/364519/in-python-how-to-i-iterate-over-a-dictionary-in-sorted-order | |
| # for testing the hash contains what it should: | |
| >>> basecount("CT") == {'A': 0, 'C': 1, 'G': 0, 'T': 1} | |
| True | |
| >>> basecount("") == {'A': 0, 'C': 0, 'G': 0, 'T': 0} | |
| True | |
| >>> basecount("CGGAAAGATGATGGAACGTT") == {'A': 7, 'C': 2, 'G': 7, 'T': 4} | |
| True | |
| >>> basecount("CGGAAAGATGATGGAACGTT",calcfreqs=True) == { 'A': 0.35, 'C': 0.1, 'G': 0.35, 'T': 0.2} | |
| True | |
| """ | |
| length = len(seq) | |
| if verbose: | |
| print("The sequence is %d base-pairs long" % length) | |
| if calcfreqs: | |
| # Make a dictionary "myfreq" to contain the frequency of each base. | |
| myfreq = {} | |
| else: | |
| # Make a dictionary "mynum" to contain the number of occurrences of each base. | |
| mynum = {} | |
| # If we want to look at every letter that appears in the sequence: | |
| if useall: | |
| myset = set(seq) | |
| # If we just want to look at the four bases A,C,G,T: | |
| else: | |
| myset = ("A", "C", "T", "G") | |
| for letter in myset: | |
| num = seq.count(letter) | |
| if calcfreqs: | |
| # Note that the frequency is calculated out of the total | |
| # sequence length, even though some bases are not A/G/C/T | |
| freq = num/length | |
| myfreq[letter] = freq | |
| if verbose: | |
| print("The frequency of %s is %.2f" % (letter, freq)) | |
| else: | |
| mynum[letter] = num | |
| if verbose: | |
| print("There are %d %s" % (num, letter)) | |
| if calcfreqs: | |
| return myfreq | |
| else: | |
| return mynum | |
| #====================================================================# | |
| # Checked and seems to work fine. | |
| # Agrees with result at http://www.computational-genomics.net/case_studies/haemophilus_demo.html | |
| def dimercount(myseq,verbose=False,calcfreqs=False): | |
| """Prints out the frequency of dimers in a long DNA sequence | |
| >>> dimercount("CGGAAAGATGATGGAACGTT") == {'AA': 3, 'AC': 1, 'AG': 1, 'AT': 2, 'GA': 4, 'GG': 2, 'GT': 1, 'CG': 2, 'TG': 2, 'TT': 1} | |
| True | |
| >>> dimercount("CGGAAAGATGATGGAACGTT",calcfreqs=True) == {'GG': 0.10526315789473684, 'CG': 0.10526315789473684, 'AG': 0.05263157894736842, 'TT': 0.05263157894736842, 'AA': 0.15789473684210525, 'AC': 0.05263157894736842, 'GT': 0.05263157894736842, 'AT': 0.10526315789473684, 'GA': 0.21052631578947367, 'TG': 0.10526315789473684} | |
| True | |
| """ | |
| # Normally we pass in a sequence object 'myseq', but in the doc-test | |
| # above, I just pass in a string: | |
| try: | |
| seq = myseq.tostring() | |
| except AttributeError: | |
| seq = myseq | |
| length = len(seq) | |
| # Define the set of dimers we are interested in | |
| myset = ("AA", "AC", "AG", "AT", "GA", "GC", "GG", "GT", | |
| "CA", "CC", "CG", "CT", "TA", "TC", "TG", "TT") | |
| # Make a dictionary "mynum" to contain the number of occurrences of each dimer. | |
| mynum = {} | |
| if calcfreqs: | |
| # Make a dictionary "myfreq" to contain the frequency of each dimer. | |
| myfreq = {} | |
| # Move the window by jumpsize bp at a time | |
| windowsize = 2 | |
| jumpsize = 1 | |
| for i in range (0, length-windowsize+1, jumpsize): | |
| subseq = seq[i:i+windowsize] | |
| # if subseq is a member of set 'myset': | |
| if subseq in myset: | |
| if subseq in mynum: # if subseq is already in dictionary 'mynum': | |
| mynum[subseq] += 1 | |
| else: | |
| mynum[subseq] = 1 | |
| for dimer in myset: | |
| # The total number of dimers in a sequence is length-1. | |
| # Note that the dimer frequency is given out of length-1, even | |
| # though some of the dimers in the sequence are not those in | |
| # "myset" above, because of non-A/G/C/T bases. | |
| if dimer in mynum: # if dimer is already in dictionary 'mynum': | |
| pc = mynum[dimer]/(length-1) | |
| if calcfreqs: | |
| myfreq[dimer] = pc | |
| if verbose: | |
| print("The frequency of %s is %d (fraction %f)" % (dimer, mynum[dimer], pc)) | |
| if calcfreqs: | |
| return myfreq | |
| else: | |
| return mynum | |
| #====================================================================# | |
| # Checked this works on a very short sequence. | |
| # Agrees with result at http://www.computational-genomics.net/case_studies/haemophilus_demo.html | |
| def ntdensity1(seq,windowsize,verbose=False,jumpsize=1000,makePlot=False): | |
| """Plots the G+C content along a sequence using a sliding window | |
| >>> ntdensity1("CGGAAAGATGATGGAACGTT",4,verbose=False,jumpsize=1) == ([2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0], {'G+C': [75.0, 50.0, 25.0, 25.0, 25.0, 25.0, 50.0, 25.0, 25.0, 50.0, 50.0, 50.0, 50.0, 50.0, 50.0, 50.0, 50.0], 'A+T': [25.0, 50.0, 75.0, 75.0, 75.0, 75.0, 50.0, 75.0, 75.0, 50.0, 50.0, 50.0, 50.0, 50.0, 50.0, 50.0, 50.0]}) | |
| True | |
| """ | |
| length = len(seq) | |
| # Make a dictionary to contain two empty lists | |
| freqs = { "G+C": [], "A+T": [] } | |
| myset = ("A+T", "G+C") | |
| # Note: instead of storing G+C, A+T in a hash, could just have coded G+C=0, A+T=1, and stored these values in arrays. | |
| midpoints = [] | |
| # Move the window by jumpsize bp at a time. | |
| # The first window we look at is from i=0 to i=windowsize. | |
| # For example, if the sequence is 30000 bases long, windowsize=10000. | |
| # In the first loop, we look at i=0 to i=10000. | |
| # In the second loop, we look at i=1000 to i=11000. ... | |
| # In the last loop, we look at i=29000 to i=30000. | |
| # Note: for i = range(0,10) goes from i=0...9. | |
| for i in range(0,length-windowsize+1,jumpsize): | |
| subseq = seq[i:i+windowsize] | |
| if verbose: | |
| start = i | |
| end = i+windowsize | |
| print("start %d end %d subseq is %s length %d windowsize %d" % (start,end,subseq,length,windowsize)) | |
| assert len(subseq)==windowsize, "ERROR: ntdensity1: length of subseq is not windowsize" | |
| for dimer in myset: | |
| letter1 = dimer[0:1] | |
| letter2 = dimer[2:3] | |
| num1 = subseq.count(letter1) | |
| num2 = subseq.count(letter2) | |
| num = num1 + num2 | |
| pc = (100 * num)/windowsize | |
| freqs[dimer].append(pc) | |
| # Find the mid-point of the window: | |
| # For example, if the window is from i=1000 to i=11000, | |
| # midpoint = 12000/2 = 6000 | |
| midpoint = (i + i + windowsize)/2 | |
| midpoints.append(midpoint) | |
| if makePlot: | |
| # Call the plotting function | |
| midpoints2 = [x/1000 for x in midpoints] # list comprehension | |
| myscatterplot(midpoints2,freqs,'Base-pair position (kb)','%') # Convert to kb for plotting | |
| # Return the results | |
| return(midpoints,freqs) | |
| #====================================================================# | |
| def myscatterplot(xvar,ydict,xlab,ylab): | |
| """Makes a scatterplot of y-variable(s) against an x-variable""" | |
| # See http://matplotlib.sourceforge.net/examples/api/date_demo.html | |
| # for where I got the plotting code from | |
| fig = plt.figure() | |
| ax = fig.add_subplot(111) | |
| yvarnames = [] | |
| for yvar in ydict: | |
| yvarnames.append(yvar) | |
| ax.plot(xvar,ydict[yvar]) | |
| ax.grid(True) | |
| plt.xlabel(xlab) | |
| plt.ylabel(ylab) | |
| ax.legend(yvarnames) | |
| plt.grid(True) | |
| plt.show() | |
| #====================================================================# | |
| # Agrees with result at http://www.computational-genomics.net/case_studies/haemophilus_demo.html | |
| # Checked this works on a very short sequence. | |
| def ntdensity2(seq,windowsize,verbose=False,jumpsize=1000,makePlot=False): | |
| """Plots the base frequency along a sequence using a sliding window | |
| >>> ntdensity2("CGGAAAGATGATGGAACGTT",4,jumpsize=1) == ([2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0, 11.0, 12.0, 13.0, 14.0, 15.0, 16.0, 17.0, 18.0], {'A': [25.0, 50.0, 75.0, 75.0, 75.0, 50.0, 25.0, 50.0, 25.0, 25.0, 25.0, 25.0, 50.0, 50.0, 50.0, 25.0, 0.0], 'C': [25.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 25.0, 25.0, 25.0], 'T': [0.0, 0.0, 0.0, 0.0, 0.0, 25.0, 25.0, 25.0, 50.0, 25.0, 25.0, 25.0, 0.0, 0.0, 0.0, 25.0, 50.0], 'G': [50.0, 50.0, 25.0, 25.0, 25.0, 25.0, 50.0, 25.0, 25.0, 50.0, 50.0, 50.0, 50.0, 25.0, 25.0, 25.0, 25.0]}) | |
| True | |
| """ | |
| length = len(seq) | |
| # make a dictionary to contain four empty lists | |
| freqs = { "A": [], "T": [], "G": [], "C": [] } | |
| myset = ("A", "C", "T", "G") | |
| midpoints = [] | |
| # Move the window by jumpsize bp at a time. | |
| for i in range(0,length-windowsize+1,jumpsize): | |
| subseq = seq[i:i+windowsize] | |
| if verbose: | |
| start = i | |
| end = i+windowsize | |
| print("start %d end %d subseq is %s length %d windowsize %d" % (start,end,subseq,length,windowsize)) | |
| assert len(subseq)==windowsize, "ERROR: ntdensity2: length of subseq is not windowsize" | |
| for letter in myset: | |
| num = subseq.count(letter) | |
| pc = 100 * num/windowsize | |
| freqs[letter].append(pc) | |
| # Find the mid-point of the window: | |
| # For example, if the window is from i=1000 to i=11000, | |
| # midpoint = 12000/2 = 6000 | |
| midpoint = (i + i + windowsize)/2 | |
| midpoints.append(midpoint) | |
| if makePlot: | |
| # Call the plotting function | |
| midpoints2 = [x/1000 for x in midpoints] # list comprehension | |
| myscatterplot(midpoints2,freqs,'Base-pair position (kb)','%') # Convert to kb for plotting | |
| # Return the results: | |
| return(midpoints,freqs) | |
| #====================================================================# | |
| def main(): | |
| Hflu = getgenbank("16271976") | |
| dimersignature(Hflu.seq) | |
| #gag = getgenbank("223601064") | |
| #dimergensign(gag.seq) | |
| #====================================================================# | |
| def runtests(): | |
| import doctest | |
| doctest.testmod() | |
| #====================================================================# | |
| if __name__=="__main__": | |
| if len(sys.argv) == 2 and sys.argv[1] == "test": | |
| runtests() | |
| sys.exit(0) | |
| main() | |
| #====================================================================# | |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment