This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
After replacing /usr/bin/gcc and /usr/bin/g++ with symlinks to GCC 5.3 binaries... | |
l-umobcdja2:freebayes Bede$ make | |
wget -q http://hypervolu.me/freebayes/build/v1.0.2-6-g3ce827d & | |
cd src && /Applications/Xcode.app/Contents/Developer/usr/bin/make | |
DETECTED_VERSION = v1.0.2-6-g3ce827d-dirty | |
CURRENT_VERSION = v1.0.2-6-g3ce827d | |
Updating version file. | |
cd ../bamtools && mkdir -p build && cd build && cmake .. && /Applications/Xcode.app/Contents/Developer/usr/bin/make | |
-- Configuring done |
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
class Spades < Formula | |
desc "SPAdes: de novo genome assembly" | |
homepage "http://bioinf.spbau.ru/spades/" | |
# tag "bioinformatics" | |
# doi "10.1089/cmb.2012.0021" | |
url "http://spades.bioinf.spbau.ru/release3.6.2/SPAdes-3.6.2.tar.gz" | |
sha256 "20897e2707623ee1033d3c88fefc42771fa4bbaafaf0f95642991d83b361eb5f" |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
l-umobcdja2:homebrew-science Bede$ brew audit spades | |
homebrew/science/spades: | |
* Non-executables were installed to "/usr/local/Cellar/spades/3.6.2/bin" | |
The offending files are: | |
/usr/local/Cellar/spades/3.6.2/bin/spades_init.pyc | |
Error: 1 problem in 1 formula | |
l-umobcdja2:homebrew-science Bede$ |
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
var tracks = [ | |
{ | |
trackName: "track1", | |
trackType: "track", | |
visible: true, | |
trackFeatures: "complex", | |
featureThreshold: 1000, | |
mouseover_callback: 'islandPopup', | |
mouseout_callback: 'islandPopupClear', | |
linear_mouseclick: 'linearPopup', |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>EDGE_1_length_179_cov_1.64557; | |
TAGCATTTTAATATTATACATAACATGGTATAATATTAGATGTGTAATATAAAATCTAAA | |
GCAACTACTACAAAAACAATACTAGAAGTTATGGCTACTAAGCCAACAAAGGATAAAAAA | |
TAGAATCAAAATTAATTAATCCAAAAGAAGGAAGTAAAAGGGAACAAAGAATAGGTGGG | |
>EDGE_1_length_179_cov_1.64557'; | |
CCCACCTATTCTTTGTTCCCTTTTACTTCCTTCTTTTGGATTAATTAATTTTGATTCTAT | |
TTTTTATCCTTTGTTGGCTTAGTAGCCATAACTTCTAGTATTGTTTTTGTAGTAGTTGCT | |
TTAGATTTTATATTACACATCTAATATTATACCATGTTATGTATAATATTAAAATGCTA | |
>EDGE_2_length_255_cov_1.11111; | |
GAAAAACTCATTCTATGAGTGAATACACTTGGCAAGAAGTAGTGGGGCTGTAATTGTGAT |
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.