boopsboops

otherCatalogNumbers	genus	specificEpithet	institutionCode	catalogNumber	country	nucleotides_CYTB	nucleotides_16S
BB-001			Boops	boops		MNHN		1978-0632	Spain	NA			TATGGAGCTTAA
BB-002			Boops	boops		MNHN		1978-0632	Spain	ATGGCTAGCCT		NA
BB-003			Boops	boops		MNHN		1978-0632	Spain	ATGGCTAGCCT		TATGGAGCTTAA

boopsboops

tab <- read.table("master.tsv", header=TRUE, sep="\t", stringsAsFactors=FALSE)
reduced_table <- tab[-which(is.na(tab$nucleotides_CYTB)), ]

boopsboops

fasta_description <- paste0(">", paste0(reduced_table$otherCatalogNumbers, "_", gene_name), " ", #
  "[organism=", reduced_table$genus, " ", reduced_table$specificEpithet, "]", " ", #
  "[Bio_material=", reduced_table$otherCatalogNumbers, "]", " ", "[Specimen-voucher=", #
  reduced_table$institutionCode, ":", reduced_table$catalogNumber, "]", " ", "[location=mitochondrion] [mgcode=2]")
fasta_complete <- paste(fasta_description, reduced_table$nucleotides_CYTB, sep="\n")# add data to fasta
write(fasta_complete, file="sequences.fsa", append=FALSE)# write out the fasta file

boopsboops

gene_name <- "CYTB"
prod_name <- "cytochrome b"

boopsboops

feature_tab <- paste0(paste0(">Feature", " ", reduced_table$otherCatalogNumbers, "_", gene_name),"\n", #
  "1", "\t", ">", nchar(reduced_table$nucleotides_CYTB), "\t", "gene", "\n", #
  "\t", "\t", "\t", "gene", "\t", gene_name, "\n", #
  "1", "\t", ">", nchar(reduced_table$nucleotides_CYTB), "\t", "CDS", "\t", "\t", "\n", #
  "\t", "\t", "\t", "product", "\t", prod_name, "\n", #
  "\t", "\t", "\t", "codon_start", "\t", "1")
write(feature_tab, file="features.tbl", append=FALSE)# write out

boopsboops

reduced_table <- tab[-which(is.na(tab$nucleotides_16S)), ]
gene_name <- "rRNA"
prod_name <- "16S ribosomal RNA"
# note that we deleted the genetic code element, as this is not a coding sequence
# also note that 'append' is now set to 'TRUE' to add the data to previously written files
fasta_description <- paste0(">", paste0(reduced_table$otherCatalogNumbers, "_", gene_name), #
  " ", "[organism=", reduced_table$genus, " ", reduced_table$specificEpithet, "]", " ", #
  "[Bio_material=", reduced_table$otherCatalogNumbers, "]", " ", "[Specimen-voucher=", #
  reduced_table$institutionCode, ":", reduced_table$catalogNumber, "]", " ", "[location=mitochondrion]")
fasta_complete <- paste(fasta_description, reduced_table$nucleotides_16S, sep="\n")# add data to fasta

boopsboops

# Here we use -a flag to specify fasta file format type, 
# the -V flag to request verification (v) and a GenBank flatfile as part of the output (b), 
# and the -T flag to tell the program to generate the higher taxonomic classifications for our record.
# Use 'tbl2asn --help' for a full list of the options

# To run if in PATH 
tbl2asn -t template.sbt -i sequences.fsa -f features.tbl -a s -V vb -T
# To run if local
./tbl2asn -t template.sbt -i sequences.fsa -f features.tbl -a s -V vb -T

boopsboops

>BB-002_CYTB [organism=Boops boops] [Bio_material=BB-002] [Specimen-voucher=MNHN:1978-0632] [location=mitochondrion] [mgcode=2]
ATGGCTAGCCTTCGAAAAACGCACCCCCTATTAAAAATTGCTAATCACGCATTAGTTGATCTCCCTGCACCCTCCAATATTTCCGTCTGATGAAATTTTGGCTCCCTGCTTGGCCTCTGTCTTATTTCCCAGCTCCTTACAGGGCTATTCCTCGCCATACACTATACCTCCGATATCGCTACAGCCTTCTCTTCCGTTGCC
>BB-003_CYTB [organism=Boops boops] [Bio_material=BB-003] [Specimen-voucher=MNHN:1978-0632] [location=mitochondrion] [mgcode=2]
ATGGCTAGCCTTCGAAAAACGCACCCCCTATTAAAAATTGCTAATCACGCATTAGTTGATCTCCCTGCACCCTCCAATATTTCCGTCTGATGAAATTTTGGCTCCCTGCTTGGCCTCTGTCTTATTTCCCAGCTCCTTACAGGGCTATTCCTCGCCATACACTATACCTCCGATATCGCTACAGCCTTCTCTTCCGTTGCC

boopsboops

>Feature BB-002_CYTB
1	>201	gene
			gene	CYTB
1	>201	CDS		
			product	cytochrome b
			codon_start	1
>Feature BB-003_CYTB
1	>201	gene
			gene	CYTB
1	>201	CDS		

boopsboops

>Feature BB-002_CYTB
1	>201	gene
			gene	CYTB
1	>201	CDS		
			product	cytochrome b
			codon_start	1
>Feature BB-003_CYTB
1	>201	gene
			gene	CYTB
1	>201	CDS