Skip to content

Instantly share code, notes, and snippets.

Embed
What would you like to do?
Calculates amino acid codon frequency
# Calculate amino acid codon frequency
from collections import defaultdict
#the first 600 nucleotides from GenBank: AAHX01097212.1
rna = ("tcccccgcagcttcgggaacgtgcgggctcgggagggaggggcctggcgccgggcgcgcg"
"cctgcgccccaccccgccccaccctggcgggtctcgcgcgcccggcccgcctcctgtcaa"
"ccccagcgcggcggtcaggtggtccccagcccttggccccagcctccagcttcctggtcc"
"ctcgggctctgagtcctgtctccggcagatcgcctttctgattgttctcctgcgcagctg"
"gaggtgtatagcccctagccgagctatggtgcctcagcagatgtgaggaggtagtgggtc"
"aggataaacccgcgcactccataataacgtgccagggctcagtgacttgggtctgcatta")
seq = rna.upper().replace('T', 'U')
#RNA codon table from http://en.wikipedia.org/wiki/Genetic_code
degenerated = (('GCU', 'GCC', 'GCA', 'GCG'),
('UUA', 'UUG', 'CUU', 'CUC', 'CUA', 'CUG'),
('CGU', 'CGC', 'CGA', 'CGG', 'AGA', 'AGG'),
('AAA', 'AAG'), ('AAU', 'AAC'), ('GAU', 'GAC'),
('UUU', 'UUC'), ('UGU', 'UGC'), ('CCU', 'CCC', 'CCA', 'CCG'),
('CAA', 'CAG'), ('UCU', 'UCC', 'UCA', 'UCG', 'AGU', 'AGC'),
('GAA', 'GAG'), ('ACU', 'ACC', 'ACA', 'ACG'),
('GGU', 'GGC', 'GGA', 'GGG'), ('CAU', 'CAC'), ('UAU', 'UAC'),
('AUU', 'AUC', 'AUA'), ('GUU', 'GUC', 'GUA', 'GUG'),
('UAA', 'UGA', 'UAG'))
#prepare the dictio of degenerated codons
degen_dict = {}
for codons in degenerated:
for codon in codons:
degen_dict[codon] = codons
#query_codons
max_seq = len(seq)
query_codons = [seq[i:i+3] for i in range(0, max_seq, 3)]
#prepare dictio of counts:
counts = defaultdict(int)
for codon in query_codons:
counts[codon] +=1
#actual calculation of frecuencies
data = {}
for codon in query_codons:
if codon in degen_dict:
totals = sum(counts[deg] for deg in degen_dict[codon])
frecuency = float(counts[codon]) / totals
else:
frecuency = 1.00
data[codon] = frecuency
#print results
for codon, frecuency in data.iteritems():
print "%s -> %.2f" %(codon, frecuency)
#produces:
GUC -> 0.57
AUA -> 1.00
ACG -> 0.50
AAC -> 1.00
CCU -> 0.25
UAU -> 1.00
..........
GCU -> 0.19
GAU -> 1.00
UAG -> 0.33
CUC -> 0.38
UUA -> 0.13
UGA -> 0.33
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment