This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
%!PS-Adobe-3.0 Resource-CMap | |
%%DocumentNeededResources: ProcSet (CIDInit) | |
%%IncludeResource: ProcSet (CIDInit) | |
%%BeginResource: CMap (MyriadPro-Regular-UCMap) | |
%%Title: (MyriadPro-Regular-UCMap callas MyriadPro-Regular-UCMap 0) | |
%%EndComments | |
/CIDInit /ProcSet findresource begin | |
12 dict begin |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python3 | |
import struct | |
import sys | |
# Directly inspired by Jeff Bryner's rdqdump: | |
# https://github.com/jeffbryner/rdqdump | |
# | |
# This does essentially the same thing, but works with the binary data directly. |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
;; for init.el | |
(defun csw/c-mode-common-setup () | |
(local-set-key (kbd "C-c C-o") 'ff-find-other-file)) | |
(add-hook 'c-mode-common-hook 'csw/c-mode-common-setup) |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/bin/ksh | |
function grab_lock { | |
pid_lock $lockfile || exit 1 | |
if [ ! -e $lockfile ]; then | |
print -u 2 "Lock file $lockfile should exist!" | |
exit 1 | |
fi | |
} |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
set print pretty on | |
set print object on | |
set print static-members on | |
set print vtbl on | |
set print demangle on | |
set demangle-style gnu-v3 | |
set print sevenbit-strings off | |
python | |
import sys |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<tool id="bio_maf_tile" name="Tile MAF blocks with reference sequence" | |
version="1.0.1"> | |
<description>Concatenates multiple alignments for a set of | |
intervals, filling gaps from a reference sequence</description> | |
<command interpreter="bash"> | |
bioruby_runner maf_tile --bed $input1 | |
#if $bed_species: | |
--bed-species $bed_species | |
#end if | |
#if $one_based then "--one-based" else ""# |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/sbin/dtrace -s | |
syscall::read:entry | |
/execname == "sambamba"/ | |
{ | |
self->ts = timestamp; | |
self->fd = arg0; | |
} | |
syscall::read:return |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env ruby | |
require 'benchmark' | |
n = 10000000 | |
line = 's tupBel1.scaffold_3803.1-85889 33686 61 + 85889 ttcaggaagggggcccaaaacgcttgagtggtcagctctta-ttttgcgtttactggatggg' | |
Benchmark.bmbm do |x| | |
x.report("basic String#split") do | |
n.times do |