skewer.log

COMMAND LINE:	skewer -z -t 2 --quiet -o trimmed test_1.fastq.gz test_2.fastq.gz
Input file:	test_1.fastq.gz
Paired file:	test_2.fastq.gz
trimmed:	trimmed-pair1.fastq.gz, trimmed-pair2.fastq.gz

Parameters used:
-- 3' end adapter sequence (-x):	AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-- paired 3' end adapter sequence (-y):	AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
-- maximum error ratio allowed (-r):	0.100
-- maximum indel error ratio allowed (-d):	0.030
-- minimum read length allowed after trimming (-l):	18
-- file format (-f):		Sanger/Illumina 1.8+ FASTQ (auto detected)
-- number of concurrent threads (-t):	2
Tue Feb 16 14:10:08 2016 >> started

Tue Feb 16 14:10:13 2016 >> done (5.263s)
100000 read pairs processed; of these:
     0 ( 0.00%) short read pairs filtered out after trimming by size control
     0 ( 0.00%) empty read pairs filtered out after trimming by size control
100000 (100.00%) read pairs available; of these:
  3885 ( 3.88%) trimmed read pairs available after processing
 96115 (96.11%) untrimmed read pairs available after processing

Length distribution of reads after trimming:
length	count	percentage
 39	     3	  0.00%
 40	     0	  0.00%
 41	     2	  0.00%
 42	     3	  0.00%
 43	     1	  0.00%
 44	     2	  0.00%
 45	     3	  0.00%
 46	     3	  0.00%
 47	     8	  0.01%
 48	     3	  0.00%
 49	     5	  0.01%
 50	     5	  0.01%
 51	     3	  0.00%
 52	     6	  0.01%
 53	     7	  0.01%
 54	    13	  0.01%
 55	     7	  0.01%
 56	    11	  0.01%
 57	    19	  0.02%
 58	    11	  0.01%
 59	    17	  0.02%
 60	    15	  0.01%
 61	    16	  0.02%
 62	    26	  0.03%
 63	    26	  0.03%
 64	    20	  0.02%
 65	    23	  0.02%
 66	    30	  0.03%
 67	    34	  0.03%
 68	    31	  0.03%
 69	    40	  0.04%
 70	    43	  0.04%
 71	    46	  0.05%
 72	    55	  0.06%
 73	    51	  0.05%
 74	    66	  0.07%
 75	    64	  0.06%
 76	    74	  0.07%
 77	    54	  0.05%
 78	    57	  0.06%
 79	    82	  0.08%
 80	    80	  0.08%
 81	    88	  0.09%
 82	    96	  0.10%
 83	   102	  0.10%
 84	    84	  0.08%
 85	   104	  0.10%
 86	   131	  0.13%
 87	   105	  0.10%
 88	   127	  0.13%
 89	   133	  0.13%
 90	   144	  0.14%
 91	   142	  0.14%
 92	   159	  0.16%
 93	   165	  0.17%
 94	   148	  0.15%
 95	   164	  0.16%
 96	   178	  0.18%
 97	   184	  0.18%
 98	   178	  0.18%
 99	   172	  0.17%
100	   216	  0.22%
101	 96115	 96.11%