Skip to content

Instantly share code, notes, and snippets.

View darthdeus's full-sized avatar

Jakub Arnold darthdeus

208 followers · 32 following
View GitHub Profile
@darthdeus
darthdeus / glow-layers.txt
Created April 14, 2019 17:49
QuantizeImage/Forward/ : x=[8, 48, 48, 3] z=[None] logdet=[8]
SqueezingLayer/Forward/Scale1 : x=[8, 24, 24, 12] z=[None] logdet=[8]
ActnormBiasLayer/Forward/ : x=[8, 24, 24, 12] z=[None] logdet=[8]
ActnormScaleLayer/Forward/ : x=[8, 24, 24, 12] z=[None] logdet=[8]
ChainLayer/Forward/ : x=[8, 24, 24, 12] z=[None] logdet=[8]
ActnormLayer/Forward/ : x=[8, 24, 24, 12] z=[None] logdet=[8]
InvertibleConv1x1Layer/Forward/ : x=[8, 24, 24, 12] z=[None] logdet=[8]
AffineCouplingLayer/Forward/ : x=[8, 24, 24, 12] z=[None] logdet=[8]
ChainLayer/Forward/Step1 : x=[8, 24, 24, 12] z=[None] logdet=[8]
ActnormBiasLayer/Forward/ : x=[8, 24, 24, 12] z=[None] logdet=[8]
@darthdeus
darthdeus / jitchol.py
Created March 8, 2019 02:07
import numpy as np
import numpy.linalg as linalg
import logging
def jitchol(A, maxtries=6):
A = np.ascontiguousarray(A)
diagA = np.diag(A)
if np.any(diagA <= 0.):
@darthdeus
darthdeus / config.yml
Created January 23, 2019 21:10
# This file is a template for a new experiment.
# It specifies how the experiment is to be created,
# but does not hold its state.
# Name of the experiment
name: {{experiment_name}}
# A List of hyperparamters to be tuned.
hyperparameters:
# Each hyperparameter needs to specify:
@darthdeus
darthdeus / vae-skeleton.py
Created January 11, 2019 13:49
import tensorflow as tf
tf.reset_default_graph()
input = tf.placeholder(dtype=tf.float32, shape=None)
def encoder(x):
return x*x
def decoder(x):
@darthdeus
darthdeus / bednarek-testbed.hpp
Created December 23, 2018 00:57
when you otevres bednarkuv kod and generic_generator appears
template< typename SP, typename SQ>
class abstract_generator {
public:
virtual ~abstract_generator() {}
void label( logger & log) const { label_( log); }
template< bool debug>
void run( logger & log, const SP & sp, const SQ & sq) const
{
if ( debug )
run_debug_( log, sp, sq);
@darthdeus
darthdeus / sequence.txt
Created July 24, 2018 08:43
ATGCATCACCACCATCACCACGGCAGCGATAGCGAAGTTAACCAAGAGGCGAAACCTGAAGTTAAGCCAGAAGTCAAACCGGAAACCCACATTAATCTGAAAGTGTCCGACGGCAGCAGCGAGATCTTCTTCAAGATCAAAAAGACCACGCCGCTGCGTCGCCTGATGGAAGCTTTTGCGAAGCGTCAGGGTAAAGAAATGGACTCTCTGACCTTTCTGTATGACGGTATCGAGATCCAAGCCGATCAGACGCCGGAAGATTTGGACATGGAAGATAATGACATTATTGAAGCGCATCGTGAGCAAATTGGTGGCGAGAACCTGTACTTCCAGGGTGGCGGCCCGCGCCTGCGCGAAGTATTGAGCAGACTGAGCCTGGGCCGTCAAGATGTTTCCGAGGCATCGGGCTTGGTTAATCAAGTCGTGAGCCAGCTGATCCAGGCCATTCGTAGCCAAGAAGGCTCCTTTGGCAGCATTGAGCGTCTGAATACCGGTAGCTATTACGAACATGTCAAAATCAGCGAACCGAACGAATTTGACATTATGCTGGTTATGCCGGTTAGCCGCCTTCAATTGGACGAGTGTGACGATACGGGTGCGTTCTATTATCTGACCTTTAAACGTAATAGCAAAGATAAGCACTTGTTCAAGTTTCTGGATGAAGATGGCAAGCTGAGCGCGTTCAAGATGCTGCAGGCACTGCGTGACATCATCAAACGTGAAGTCAAGAATATCAAAAATGCAGAGGTCACCGTCAAGCGTAAAAAAGCTGGCAGCCCGGCGATTACGCTGCAAATCAAAAACCCGCCGGCCGTGATCAGCGTTGATATTATCCTGACTCTGGAACCACAACAAAGCTGGCCGCCGTCTACCCAGGACGGCCTGAAAATTGAGAAATGGCTGGGTCGCAAAGTGCGTGGTCAGTTCCGTAACAAGTCACTGTATTTGGTTGCGAAGCAAAACAAGCGCGAAAAAGTTCTGCGCGGTAACACGTGGCGCATTAGCTTTAGCCATATTGAAAAAG
@darthdeus
darthdeus / tf-error.log
Last active May 20, 2018 19:54
$ bazel build --jobs=12 --config=opt --config=cuda //tensorflow/tools/pip_package:build_pip_package --verbose_failures @93bc2e2072
WARNING: The following configs were expanded more than once: [cuda]. For repeatable flags, repeats are counted twice and may lead to unexpected behavior.
WARNING: /home/darth/.cache/bazel/_bazel_darth/08554d152596e5a7df399506682a63f3/external/protobuf_archive/WORKSPACE:1: Workspace name in /home/darth/.cache/bazel/_bazel_darth/08554d152596e5a7df399506682a63f3/external/protobuf_archive/WORKSPACE (@com_google_protobuf) does not match the name given in the repository's definition (@protobuf_archive); this will cause a build error in future versions
WARNING: /home/darth/.cache/bazel/_bazel_darth/08554d152596e5a7df399506682a63f3/external/grpc/WORKSPACE:1: Workspace name in /home/darth/.cache/bazel/_bazel_darth/08554d152596e5a7df399506682a63f3/external/grpc/WORKSPACE (@com_github_grpc_grpc) does not match the name given in the repository's definition (@grpc); this will cause a bui
@darthdeus
darthdeus / min-char-rnn.py
Created March 16, 2018 17:09 — forked from karpathy/min-char-rnn.py
Minimal character-level language model with a Vanilla Recurrent Neural Network, in Python/numpy
"""
Minimal character-level Vanilla RNN model. Written by Andrej Karpathy (@karpathy)
BSD License
"""
import numpy as np
# data I/O
data = open('input.txt', 'r').read() # should be simple plain text file
chars = list(set(data))
data_size, vocab_size = len(data), len(chars)
@darthdeus
darthdeus / eva-knizky.md
Last active February 21, 2018 15:02

EVA 2

  • Eiben, Smith: Intro to Evolutionary Computing
  • Michalewitz: GA + DS = EP
  • Mitchell: Intro to GA
  • Field Guide to GP (FREE!)
  • Koza: NECIST

Multiagentni systemy

@darthdeus
darthdeus / gist:d96cd056ab7725d42676f2882dc3918b
Created May 3, 2017 22:06
(tf-35) c:\dev>python check_blas.py
WARNING (theano.sandbox.cuda): The cuda backend is deprecated and will be removed in the next release (v0.10). Please switch to the gpuarray backend. You can get more information about how to switch at this URL:
https://github.com/Theano/Theano/wiki/Converting-to-the-new-gpu-back-end%28gpuarray%29
Using gpu device 0: GeForce GTX 1080 Ti (CNMeM is disabled, cuDNN 6021)
C:\dev\Anaconda2\envs\tf-35\lib\site-packages\theano\sandbox\cuda\__init__.py:631: UserWarning: Your cuDNN version is more recent than the one Theano officially supports. If you see any problems, try updating Theano or downgrading cuDNN to version 5.1.
warnings.warn(warn)
Some results that you can compare against. They were 10 executions
of gemm in float64 with matrices of shape 2000x2000 (M=N=K=2000).