Test script for AppliedProgramming course, Exercise 6

Pattern.t

use Test::More tests => 15;
use Pattern;
use Restriction;
use strict;
use warnings;

# sequences for testing
my $testsequence0 = "AAAAAAAAAACGATCTAAAAAAA" ; #should not match
my $testsequence1 = "AAAAAAAAAAAGATCCAAAAAAA" ; #should match
my $testsequence2 = "AAAAAAAAAAGGATCTAAAAAAA" ; #should match
my $testsequence3 = "AAAAAAAAAAGGATCTCCCCCCCGGATCTAAAAAAA" ; #should match and has two restriction sites
my $testsequence4 = "ATCTAAAAAAAAAAAAAAAAAGG" ; #should only work if marked circular

my $testpattern = "[AG]GATC[TC]" ;
my @matchStart;

#start position for non-circular cases
@matchStart = Pattern::getPatternMatchPositions('sequence' => $testsequence0,
                                                'pattern' => $testpattern);
is(@matchStart, 0);
@matchStart = Pattern::getPatternMatchPositions('sequence' => $testsequence1,
                                                'pattern' => $testpattern);
is($matchStart[0], 11);
is(scalar(@matchStart), 1);
@matchStart = Pattern::getPatternMatchPositions('sequence' => $testsequence2,
                                      'pattern' => $testpattern);
is($matchStart[0], 11);
is(scalar(@matchStart), 1);

@matchStart = Pattern::getPatternMatchPositions('sequence' => $testsequence3,
                                      'pattern' => $testpattern);
is($matchStart[0], 11);
is($matchStart[1], 24);
is(scalar(@matchStart), 2);

@matchStart = Pattern::getPatternMatchPositions('sequence' => $testsequence4,
                                      'pattern' => $testpattern);
is(@matchStart, 0);

#start pos of matches for circular sequences
@matchStart = Pattern::getPatternMatchPositions('sequence' => $testsequence0,
                                      'pattern' => $testpattern,
                                      'is_circular' => 'Yes');
is(@matchStart, 0);

@matchStart = Pattern::getPatternMatchPositions('sequence' => $testsequence1,
                                      'pattern' => $testpattern,
                                      'is_circular' => 'Yes');
is($matchStart[0], 11);

@matchStart = Pattern::getPatternMatchPositions('sequence' => $testsequence2,
                                      'pattern' => $testpattern,
                                      'is_circular' => 'Yes');
is($matchStart[0], 11);

@matchStart = Pattern::getPatternMatchPositions('sequence' => $testsequence3,
                                      'pattern' => $testpattern,
                                      'is_circular' => 'Yes');
is($matchStart[0], 11);
is($matchStart[1], 24);

@matchStart = Pattern::getPatternMatchPositions('sequence' => $testsequence4,
                                      'pattern' => $testpattern,
                                      'is_circular' => 'Yes');
is($matchStart[0], 22);