This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python | |
import os | |
os.environ['USE_PYGEOS'] = '0' | |
import geopandas as gpd | |
import pandas as pd | |
import numpy as np | |
from shapely.geometry import Polygon, Point | |
import argparse | |
import h5py |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env julia | |
using IntervalTrees | |
using Bio.Intervals: Interval | |
function random_interval(seqname, minlen, maxlen, minstart, maxstart) | |
first = rand(minstart:maxstart) | |
last = first + rand(minlen:maxlen) - 1 | |
return Interval(seqname[1:end], first, last) | |
end |
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
module BGZF | |
using BufferedStreams, Libz | |
# compressed and decompressed blocks are <= this in BGZF | |
const MAX_SIZE = 65536 |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
using SQLite | |
# generate some random data | |
function binned_data(xbins, ybins, n) | |
xs = rand(n) | |
ys = rand(n) | |
# bin data | |
bins = zeros(Float64, (xbins, ybins)) |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
function main() | |
if length(ARGS) < 2 | |
println(STDERR, "Usage: fastq_rnd_seek_proper.jl filename numsamples") | |
exit() | |
end | |
filename = ARGS[1] | |
numsamples = parse(Int, ARGS[2]) | |
pattern = r"@.+[\n\r]+[A-Z-]+[\n\r]+\+[\n\r]+.+[\n\r]{0,1}" |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# Note: This only works on julia-0.4 currently. | |
using Bio.Seq | |
include("fogsaa.jl") | |
scoring = AlignmentScoring(2, -1, -3, -1) | |
FOGSAA( | |
dna"AACGTACGTACAATAGTTTTACGATAACCGATAGCGATACCCATTAGACTATA", |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
x=[ -1.2 | |
-1.19868 | |
-1.1947 | |
-1.18809 | |
-1.17886 | |
-1.16703 | |
-1.15263 | |
-1.1357 | |
-1.11627 |
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
Loading
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
NewerOlder