wabi_blast_ruby_example.txt

$ tree -F
.
├── blast_condition.fasta
├── blast_condition.txt
└── example.rb
$ ls -l
合計 12
-rw-r--r-- 1 user users  189  6  6 13:28 blast_condition.fasta
-rw-r--r-- 1 user users  110  6  6 13:30 blast_condition.txt
-rw-r--r-- 1 user users 2781  6  6 13:36 example.rb
$ cat blast_condition.fasta
>my query sequence 1
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC
$ cat blast_condition.txt
datasets        ddbjall
database        hum
program blastn
parameters      -v 100 -b 100 -e 10 -F F -W 11
format  json
result  www
$ ruby example.rb
Load BLAST condition
POST : success (Request-ID=wabi_blast_2013-0606-1336-31-681-634313)
2013-06-06 13:36:54 +0900: waiting
2013-06-06 13:36:56 +0900: waiting
2013-06-06 13:36:57 +0900: running
2013-06-06 13:37:01 +0900: finished
Request : finished
GET BLAST result : success
$ ls -l
合計 76
-rw-r--r-- 1 user users   189  6  6 13:28 blast_condition.fasta
-rw-r--r-- 1 user users   110  6  6 13:30 blast_condition.txt
-rw-r--r-- 1 user users  2781  6  6 13:36 example.rb
-rw-r--r-- 1 user users 63806  6  6 13:37 wabi_blast_2013-0606-1336-31-681-634313.txt
$ head wabi_blast_2013-0606-1336-31-681-634313.txt
BLASTN 2.2.26 [Sep-21-2011]

Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
"Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs",  Nucleic Acids Res. 25:3389-3402.

Query= my query sequence 1
         (165 letters)
$ tail wabi_blast_2013-0606-1336-31-681-634313.txt
Length adjustment: 20
Effective length of query: 145
Effective length of database: 5,078,288,990
Effective search space: 736351903550
Effective search space used: 736351903550
X1: 11 (21.8 bits)
X2: 15 (29.7 bits)
X3: 50 (99.1 bits)
S1: 13 (26.3 bits)
S2: 18 (36.2 bits)
$