This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/perl | |
# usage: perl wabi-client conf.json | |
use strict; | |
use warnings; | |
use LWP::UserAgent; | |
use HTTP::Request::Common; | |
use JSON qw/encode_json decode_json/; |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
// -*- java -*- | |
import java.io.BufferedReader; | |
import java.io.FileReader; | |
import java.io.FileWriter; | |
import java.io.IOException; | |
import java.util.Map; | |
import java.util.HashMap; | |
import java.util.Date; | |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>my query sequence 1 | |
CACCCTCTCTTCACTGGAAAGGACACCATGAGCACGGAAAGCATGATCCAGGACGTGGAA | |
GCTGGCCGAGGAGGCGCTCCCCAGGAAGACAGCAGGGCCCCAGGGCTCCAGGCGGTGCTG | |
GTTCCTCAGCCTCTTCTCCTTCCTGCTCGTGGCAGGCGCCGCCAC |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<project xmlns="http://maven.apache.org/POM/4.0.0" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" | |
xsi:schemaLocation="http://maven.apche.org/POM/4.0.0 http://maven.apache.org/maven-v4_0_0.xsd"> | |
<modelVersion>4.0.0</modelVersion> | |
<groupId>jp.ac.nig.ddbj</groupId> | |
<artifactId>wabi-client</artifactId> | |
<version>1</version> | |
<properties> | |
<compiler.version>1.6</compiler.version> | |
</properties> |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# -*- ruby -*- | |
require "json" | |
require "net/http" | |
require "uri" | |
class BlastCondition | |
attr_accessor :params | |
def initialize | |
self.params = { |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
$ tree -F | |
. | |
├── blast_condition.fasta | |
├── blast_condition.txt | |
└── example.rb | |
$ ls -l | |
合計 12 | |
-rw-r--r-- 1 user users 189 6 6 13:28 blast_condition.fasta | |
-rw-r--r-- 1 user users 110 6 6 13:30 blast_condition.txt | |
-rw-r--r-- 1 user users 2781 6 6 13:36 example.rb |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
BLASTN 2.2.26 [Sep-21-2011] | |
Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, | |
Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), | |
"Gapped BLAST and PSI-BLAST: a new generation of protein database search | |
programs", Nucleic Acids Res. 25:3389-3402. | |
Query= my query sequence 1 | |
(165 letters) | |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import java.util.LinkedHashMap; | |
import org.springframework.util.LinkedMultiValueMap; | |
import org.springframework.util.MultiValueMap; | |
import org.springframework.web.client.RestTemplate; | |
import org.springframework.web.client.HttpClientErrorException; | |
import net.arnx.jsonic.JSON; | |
/* | |
* (中略) | |
*/ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import java.util.LinkedHashMap; | |
import org.springframework.util.LinkedMultiValueMap; | |
import org.springframework.util.MultiValueMap; | |
import org.springframework.web.client.RestTemplate; | |
import org.springframework.web.client.HttpClientErrorException; | |
import net.arnx.jsonic.JSON; | |
/* | |
* (中略) | |
*/ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import java.util.LinkedHashMap; | |
import org.springframework.util.LinkedMultiValueMap; | |
import org.springframework.util.MultiValueMap; | |
import org.springframework.web.client.RestTemplate; | |
import org.springframework.web.client.HttpClientErrorException; | |
import net.arnx.jsonic.JSON; | |
/* | |
* (中略) | |
*/ |
OlderNewer