Skip to content

Instantly share code, notes, and snippets.

Embed
What would you like to do?
common_otus.fasta
>denovo1793
GGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCCGATCACCCTCTCAGGTCGGCTATGTATCGTCGCCTTGGTGAGCCGTTACCCCACCAACTAGCTAATACAACGCAGGTCCATCTGGTAGTGATGCAATTGCACCTTTTAATTGACTATCATGCAATAGTCAATATTATGCGGTATTAGCTATCGTTTCCAATAGTTATCCCCCGCTACCAGGCAGGTTACCTACGCGTTACTCACCCGTTCGCAACTCATCCAGAGAAGCAAGCTCCTCCTTCAGCGTTCTACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC
>denovo2518
GGAGTTTGGGCCGTGTCTCAGTCCCAATGTGGCCGATCACCCTCTCAGGTCGGCTATGCATCACGGCCTTGGTGAGCCGTTACCTCACCAACTAGCTAATGCACCGCGGGTCCATCCATCAGCAGAAGCTTGCGCCTCTTTTCCTCTTCAAACCATGCGGTTCGAAGACCTATGCGGTTTTAGCATCCGTTTCCGAATGTTATCCCCCTCTGATGGGCAGGTTACCCACGTGTTACTCACCCGTTCGCCACTAGATTGACCAGTGCAAGCACCGGTCGCTCTCGTTCGACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC
>denovo271
GGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCCGATCACCCTCTCAGGTCGGCTATGTATCGTCGCCTTGGTGAGCCGTTACCCCACCAACTAGCTAATACAACGCAGGTCCATCTGGTAGTGATGCAATTGCACCTTTTAAGCAAATGTCATGCAACATTTACTGTTATGCGGTATTAGCTATCGTTTCCAATAGTTATCCCCCGNTACCAGGCAGGTTACCTACGCGTTACTCACCCGTTCGCAACTCGTCCAGAAGAGCAAGCTCTCCCTTCAGCGTTCTACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC
>denovo3052
GGAGTCTGGTCCGTGTCTCAGTACCAGTGTGGGGGTTCAACCTCTCAGTTCCCCTACCCATCGTCGCCTTGGTGAGCCGTTACCTCACCAACTAGCTAATGGGACGCATGCCTATCTCACAGCGAAGTTCATTTCCTCTACATTGGATGCCCAACATAGAGTGTACGCGGTATTAGTCCGTCTTTCGACGGGTTATCCCCCTCTGTGAGGCAAGTTGCATACGCGTTACGCACCCGTGCGCCGGTCGCCATCAGTCTTAGCAAGCTAAGACCATGCTGCCCCTCGACTTGCATGTGTTAAGCCTATCGCTAGCGTTCATC
>denovo3230
GGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCTGATCATCCTCTCAGACCAGCTACTGATCGTCGCCTTGGTAGGCCGTTACCCCACCAACTAGCTAATCAGACGCGGGCCGATCCTTCGGCAGTAAACCTTTCCCCAAAAGGGCGTATCCGGTATTAGCGCAAGTTTCCCTGCGTTATTCCGAACCAAAGGGTACGTTCCCACGTGTTACTCACCCGTCTGCCACTCCCGTCCGAAGACGAGCGTTCGACTTGCATGTGTTAAGCCTGCCGCCAGCGTTCGCT
>denovo4257
GGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCCGGTCACCCTCTCAGGTCGGCTACGCATCGTCGCCTTGGTGGGCCGTTACCTCACCAACTAGCTAATGCGCCGCGGGCTCATCCGACACCGACGCGAACGCGTCTTTTCCTTCTCGGCCATGCGGCCAAGAAGACCATCCGGTATTAGCACTCGTTTCCAAGCGTTATCCCAGAGTATCGGGCAGATTGCCCACGTGTTACTCACCCGTCCGCCGCTGACCCCGAAAGGTCCGCTCGACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC
>denovo4324
GGAGTAAGGGCCGTATCTCAGTCCCCTTGTGGCCGTCCACCCTCTCAGGCCGGCTACCTATCTTCGCCTTGGTGGGCCGTTACCCCTCCAACTAGCTAATAGGACGCAAGGCTCTCCGCAGGCGTCTCCTTTCATCACTAAGCTATGCAGCTTAATGACCTTATCCGGTATTATCAGCAGTTTCCTGCTGTTATCCCAGTCCCGCAGGCAAGTTCCTTACGCGTTACTCACCCGTCCGCCATGGTTACCATGGTGCAAGCACCACTTCCCCATCGACTTGCATGTGTTAAGCATTCTGTCAGCGTTCATC
>denovo4994
GGAGTTTGGACCGTGTCTCAGTTCCAATGTGGGGGACCTTCCTCTCAGAACCCCTACTGATCGATGCCTTGGTGGGCCGTTACCCCGCCAACAAGCTAATCAGACGCATCCCCATCCATAACCGAAATTCTTTGCTCTATAAAAGATGCCTAATAAAGAGAACATAAGGTATTAGACCGCATTTCTACGGAGTATCCCTTTGTTATGGGAAGGTTGGATACGCGTTACTCACCCGTGCGCCGGTCGACGACAAAAAGCAGCAAGCTGCTTTCCCGTTTCCCCTCGACTTGCATGTGTTAAGCCTGTAGCTAGCGTTCATC
>denovo5010
GGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCGGATCATCCTCTCAGACCCGCTACAGATCGTCGCCTTGGTAGGCCTTTACCCCACCAACTAGCTAATCCGACTTAGGCTCATCTATTAGCGCAAGGCCCGAAGGTCCCCTGCTTTCTCCCGTAGGACGTATGCGGTATTAGCATCCCTTTCGAGATGTTGTCCCCCACTAATAGGCAGATTCCTAAGCATTACTCACCCGTCCGCCGCTAGGTCAGGTAGCAAGCTACCTTTCCCCGCTCGACTTGCATGTGTTAAGCCTGCCGCCAGCGTTCAAT
>denovo63
GGAGTTTGGGCCGTGTCTCAGTCCCAATGTGGCCGATCACCCTCTCAGGTCGGCTATGCATCACGGCCTTGGTGAGCCGTTACCTCACCAACTAGCTAATGCACCGCGGGTCCATCCATCAGCAGAAGCCGAAGCCTCTTTTCCTTCTTCAGTCATGCGACTGTAGAACCTATGCGGTTTTAGCATCCGTTTCCGAATGTTATCCCCCTCTGATGGGCAGGTTACCCACGTGTTACTCACCCGTTCGCCACTAGATTGACCAGTGCAAGCACCGGTCGCTCTCGTTCGACTTGCATGTATTAGGCACGCCGCCAGCGTTCGTC
>denovo712
GGAGTCTGGTCCGTGTCTCAGTACCAGTGTGGGGGTTCAACCTCTCAGTTCCCCTACCCATCGTCGCCTTGGTGAGCCGTTACCTCACCAACTAGCTAATGGGACGCATGCCTATCTCACAGCGAATTTCATTTCCTTGGGATAGGATGCCCTATCCCAAGTGTACGCGGTATTAGTCCGTCTTTCGACGGGTTATCCCCCTCTGTGAGGCAAGTTGCATACGCGTTACGCACCCGTGCGCCGGTCGCCATCAGTCTTAGCAAGCTAAGACCATGCTGCCCCTCGACTTGCATGTGTTAAGCCTATCGCTAGCGTTCATC
>denovo812
GGAGTCTGGGCCGTGTCTCAGTCCCAGTGTGGCGGATCATCCTCTCAGACCCGCTACTGATCGTCGCCTTGGTAGGCCTTTACCCCACCAACTAGCTAATCAGATATCGGCCGCTCGAATAACGCAAGGCCCGAAGGTCCCCTGCTTTCCTCCTCAGAGAATATGCGGTATTAGCTAATCTTTCGATTAGTTATCCCCCATTACTCGGTACGTTCCGATATATTACTCACCCGTTCGCCACTCGCCACCCAAGAAGCAAGCTTCTCTGTGCTGCCGTCCGACTTGCATGTGTAAAGCATGCCGCCAGCGTTCAAT
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
You can’t perform that action at this time.