Skip to content

Instantly share code, notes, and snippets.

View edahlgren's full-sized avatar

Erin Dahlgren edahlgren

35 followers · 0 following
View GitHub Profile
@edahlgren
edahlgren / gist:60baf107569d1d20c97c184c4f2f9df3
Created December 7, 2018 19:47
$ mvn compile -e -rf :org.lamport.tlatools
...
[INFO] ------------------------------------------------------------------------
[INFO] Building org.lamport.tla.toolbox.uitest 1.0.0-SNAPSHOT
[INFO] ------------------------------------------------------------------------
[INFO] ------------------------------------------------------------------------
[INFO] Reactor Summary:
[INFO]
[INFO] org.lamport.tlatools ............................... SUCCESS [ 8.409 s]
[INFO] org.lamport.tlatools.api ........................... SUCCESS [ 0.004 s]
@edahlgren
edahlgren / gist:95e651cdf924c2f81088c768802cc7b3
Created December 7, 2018 19:38
(On Ubuntu 16.04)
# Clone repo
$ git clone https://github.com/tlaplus/tlaplus.git
# Install Java 8
$ sudo add-apt-repository ppa:webupd8team/java
$ sudo apt update
$ sudo apt install oracle-java8-installer
$ javac -version
@edahlgren
edahlgren / gist:20e208e9a009ab90ecb9772a5b5a60c8
Created December 7, 2018 19:29
$ mvn compile -rf :org.lamport.tlatools
...
[INFO] ------------------------------------------------------------------------
[INFO] Building org.lamport.tla.toolbox.uitest 1.0.0-SNAPSHOT
[INFO] ------------------------------------------------------------------------
[INFO] ------------------------------------------------------------------------
[INFO] Reactor Summary:
[INFO]
[INFO] org.lamport.tlatools ............................... SUCCESS [ 8.395 s]
[INFO] org.lamport.tlatools.api ........................... SUCCESS [ 0.004 s]
@edahlgren
edahlgren / RingBalance.hs
Created July 6, 2013 02:34
Empirically test the non-uniformness of a hash ring for different server, replication, and bit-space values. Uses Jenkin's hash.
import Data.Bits
import System.IO
import qualified Data.List as L
import qualified Data.Vector as V
import qualified Data.HashMap.Strict as HM
import Statistics.Test.ChiSquared
import Data.BloomFilter.Hash
best :: Int -> Int -> Int
best servers bits = 2^bits `div` servers
@edahlgren
edahlgren / crazy.hs
Created June 16, 2013 21:51
trace :: ((input, feedback) -> (output, feedback)) -> input -> output
trace f input = output
where (output, feedback) = f (input, feedback)
@edahlgren
edahlgren / sequence_task.py
Created June 6, 2013 04:52
sequenceA = 'actgatcgattgatcgatcgatcg'
sequenceB = 'tttagatcgatcttgatc'
"""
Task: Uppercase (highlight) the most similar subsequence in sequenceA and sequenceB. In other words, align sequenceA and sequenceB so they best match.
Why is this useful? If the sequences are big, or you have a lot of sequence pairs, this is tiresome and error prone.
"""
@edahlgren
edahlgren / sequential.py
Created June 3, 2013 20:23
import time
"""
Here's your function/task you want to make parallel
In your case the time.sleep would be replaced with lots
of computation
"""
def computation(threadid):
print "starting thread ", threadid
time.sleep(2)
@edahlgren
edahlgren / parallel.py
Created June 3, 2013 20:21
import time
from multiprocessing import Process
"""
Here's your function/task you want to make parallel
In your case the time.sleep would be replaced with lots
of computation
"""
def computation(threadid):
print "starting thread ", threadid