elliotdavies

var PS = {};

// Either need to rename FFI modules (e.g. `$PS["Effect.Console.FFI"]`) or else
// combine them as shown here to avoid recursive promise calls
(function($PS) {
  $PS["Effect.Console"] = $PS["Effect.Console"] || Promise.resolve({});
  $PS["Effect.Console"] = $PS["Effect.Console"].then(exports => {
    exports["log"] = function(s) {
      return function() {
        console.log(s);

elliotdavies

# FizzBuzz

Write a program that prints the numbers from 1 to 100, except:

 - For multiples of 3, print "Fizz" instead of the number
 - For multiples of 5, print "Buzz" instead of the number
 - For multiples of both 3 and 5, print "FizzBuzz" instead of the number

## Extension

elliotdavies

# DNA sequences

You're working in a scientific laboratory that specialises in DNA research. Cool!

Each sequence of DNA is made up of four bases: A, C, G and T. Your job is to count how many times each base appears in a particular sequence. You quickly get bored of doing this by hand and decide to write a program to do it for you.

You have the following sequence:

`"GCAACTCTCTATTGTGCCGGAAGTTAATATGCAAAGAGTAATTTCCCATCCCCACTACCGAATCCCTGACCAACCGCCTTCTTCAGGGTGATTACGTGCTAAGCTTATTAGCGCTCTCTTTTCCGATTCACTGTTCAAGATCGTCATTTTCGGGACCATTCCTTGATTCACACACTGAACGATTATGAGGTGTATACGAAACGGGTAGAGGCCCGCAAATGCGTCCTCGATACAGATGCTCGGGTCTGTTCCTGCACGGGCACGTAAACAGCGTGTTAAGGGAGAAAGTGTGAGTGTGAAGATGAATTAAAGGCTTATCAGCCACGGCTTCAAAGACTATAGCAACGCAGAGGAACCGAGCATTTCCATCCCAGCTCATGGTAATTTACTACGGGAGCTAACGCCAGAGGTAATATTTCTG    TCTGGCAGGTTTTATTAGCCGGGTGGGAGGGAGGAAGGAGTTGAAACTCGTTACCCAATTACTCGAAGGTGTACTATTACTTCTTTGGAGATCAACTGCAGTTTGCTTGGTAACACTCACATATAAATTGTGTACTGGGTCCCATTACTTTTTCTAGGGAGTAATTAAGTTATCCCTTAGCGAATATGATGCGGCTTTGGCTTTTGGCTTAACTACCCGAAAACCAGT

elliotdavies

# String matrices

You're working on a piece of code that deals with matrices of numbers. Unfortunately, you have to integrate with a legacy system that gives you the matrices as strings.

The legacy system gives you some strings like so:

`1,2,3 4,5,6 7,8,9`

All rows are guaranteed to be the same length (you don't have to check for this) and are separated by spaces. Numbers in a row do _not_ have spaces between them and are separated by commas.

elliotdavies

# School years

You're helping your school design a new admin system. You've been given a list of students' names along with their school year. The data looks like so:


Name    | Year
--------|-----
Amy     | 1
Bob     | 3
Charlie | 2

elliotdavies

import React                            as React
import React.DOM                        as DOM
import React.DOM.Props                  as Props
import React.SyntheticEvent             (currentTarget)
import Web.HTML.HTMLElement             (focus)

import Unsafe.Coerce (unsafeCoerce)


type MyState

elliotdavies

-- In `f` we want to keep piping (part of) the result of one function into
-- another, and stop as soon as something fails
f :: [A] -> Either String (B, [A])
f xs =
  case f1 xs of
    Left s -> Left s
    Right (res1, xs') ->
      case f2 xs' of
        Left s -> Left s
        Right (res2, xs'') ->

elliotdavies

// Fab Four technique: https://medium.freecodecamp.com/the-fab-four-technique-to-create-responsive-emails-without-media-queries-baf11fdfa848#.65xejb13e
// (Credit to Rémi Parmentier)

// This SASS mixin can be applied to each responsive block
// The parent container of such blocks will want to use `font-size: 0;` to avoid inline-block spacing issues
@mixin responsive ($mobilePc, $desktopPc, $desktopAbs, $bp: 660, $neg: false) {
  display: inline-block;
  vertical-align: top;

  // Mobile size as a %