A Java small class to find all the genes in a DNA string. The library edu.duke is a dependency for the class to work, it should be added into the Java IDE to compile with no errors. Download link http://www.dukelearntoprogram.com/downloads/archives/courserajava.jar

FindMultipleGenes.java

/**
 * Find all the genes in a DNA string.
 * 
 * @author (Elvis Morales) 
 * @version (1.0)
 */
public class FindMultipleGenes {
    
    public int findStopIndex(String dna, int index) {
        
        int stop1 = dna.indexOf("tga", index);
        if ( stop1 == -1 || ( stop1-index ) % 3 != 0 ) {
            stop1 = dna.length();
        }
        
        int stop2 = dna.indexOf("taa", index);
        if ( stop2 == -1 || ( stop2-index ) % 3 != 0 ) {
            stop2 = dna.length();
        }
        
        int stop3 = dna.indexOf("tag", index);
        if ( stop3 == -1 || ( stop3-index ) % 3 != 0 ) {
            stop3 = dna.length();
        }
        
        return Math.min( stop1, Math.min(stop2, stop3) );
    }
    
    public void printAll(String dna) {
        
        String dnaLow = dna.toLowerCase();
        
        int start = 0;
        
        while (true) {
            
            int loc = dnaLow.indexOf( "atg", start );
            
            if ( loc == -1 ) {
                break;
            }
            
            int stop = findStopIndex( dnaLow, loc+3 );
            
            if ( stop != dna.length() ) {
                System.out.println( dna.substring(loc, stop+3) );
                start = stop + 3;
            } else {
                start = start + 3;
            }
               
        }
        
    }
    
    public void testFinder() {
        
        String dna = "CATGTAATAGATGAATGACTGATAGATATGCTTGTATGCTATGAAAATGTGAAATGACCCA";
       
        System.out.println("DNA string is: \n" +dna);
        System.out.println("Genes found are:");
        printAll(dna);
        
    }

}