Last active
August 29, 2015 14:14
-
-
Save gnp/251edb42ace55c4103c6 to your computer and use it in GitHub Desktop.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
> Fake Line | |
AGCTACGACTAGCCGCGCGCTATATACTAGCATCGACATTTTTATATTAAGACGAGACTATCATATACTAGCGAGCGCGGCACTATATTTGCTCGACTACACAGCCATCAAGATCAACACATATATACTTCCCCTATACACCAACACAGCGGGGACGAATACTATCATCATCATCATCAGCGCGCGCGCAGCAGAGGAAGGAAGGAATTCCTCTACTCTATTTATAGACGCGASAGCAG | |
> New Line | |
AGTAGAT | |
> Cat | |
> Doghead | |
AGTCG | |
GAT | |
GGG | |
C | |
GAGTCAG | |
> Noodles | |
G |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import scala.io.Source | |
object FastaTestMain { | |
val header = """^>\s*(.*?)\s*$""".r // Allows destructuring pattern match in parse() | |
case class FastaItem(header: String, sequence: String) | |
def readFile(filename: String): Iterator[FastaItem] = { | |
val conditioned = Source.fromFile("fasta.txt").getLines.map(_.trim).filter(_ != "") // Trim and skip blank lines | |
val start: (Option[String], Option[String]) = (None, None) // Tuple: At start, no header (left) and no sequence (right) | |
val parsed = conditioned.scanLeft(start) { case x@(state, line) => x match { | |
case (_, header(h)) => (Some(h), None) // If we see a header, remember it in the state going forward | |
case ((ho, _), s) => (ho, Some(s)) // If we see a sequence, associate it to the remembered header from the state | |
} | |
} | |
for { | |
(ho, so) <- parsed // Iterate over the pairs of optional header and optional sequence | |
h <- ho // Only keep the pair if it has a header | |
s <- so // Only keep the pair if it has a sequence | |
} yield FastaItem(h, s) | |
} | |
def main(args: Array[String]): Unit = { | |
for (i <- readFile("fasta.txt")) { | |
println(i) | |
} | |
} | |
} |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment