Built with blockbuilder.org
forked from grybnicky's block: Repeat finder circle ruler
forked from anonymous's block: Repeat finder circle ruler
Built with blockbuilder.org
forked from grybnicky's block: Repeat finder circle ruler
forked from anonymous's block: Repeat finder circle ruler
[{ | |
"name": 1, | |
"pham": 7, | |
"sequence": "ATGCTACGTAGCTACGTACGATCGTACGATCGATCGTACG", | |
"start": 50, | |
"stop": 2000, | |
"direction": "forward" | |
}, | |
{ | |
"name": 2, | |
"pham": 201, | |
"sequence": "GACTGACTGACTAGCTGACTGATCGTACTCGAT", | |
"start": 2150, | |
"stop": 2900, | |
"direction": "reverse" | |
}, | |
{ | |
"name": 3, | |
"pham": 90, | |
"sequence": "ATCGTACGTACGTACGTACGATCGTACGATCGCGCGCGCGGCGCATCGATCGATCGTACTA", | |
"start": 3000, | |
"stop": 4550, | |
"direction": "reverse" | |
}, | |
{ | |
"name": 4, | |
"pham": 3752, | |
"sequence": "TTCTAGTCGATCGTACGTGTACGTGCATTATTGATGCTATATATCGTATATACGTA", | |
"start": 4700, | |
"stop": 7550, | |
"direction": "forward" | |
} | |
] |
<!DOCTYPE html> | |
<head> | |
<meta charset="utf-8"> | |
<script src="https://cdnjs.cloudflare.com/ajax/libs/d3/3.5.5/d3.min.js"></script> | |
<link rel="stylesheet" type="text/css" href="http://fonts.googleapis.com/css?family=Roboto+Slab:400,100,300,700"> | |
<link rel="stylesheet" type="text/css" href="http://fonts.googleapis.com/css?family=Roboto:400,100,100italic,300,300italic,400italic,500,500italic,700,700italic,900,900italic"> | |
<style> | |
body { margin:0;position:fixed;top:0;right:0;bottom:0;left:0; } | |
svg { width:100%; height: 100% } | |
</style> | |
</head> | |
<body> | |
<script> | |
var svg = d3.select("body").append("svg") | |
svg.append("circle") | |
.attr({cx: 300, cy: 300, r: 200}) | |
.style({ fill: "green", opacity: 1}) | |
.attr({stroke: "black"}); | |
//Add code for line ticks | |
svg.append("circle") | |
.attr({cx: 300, cy: 300, r: 150}) | |
.attr({stroke: "black"}) | |
.style({ fill: "white", opacity: 1}); | |
d3.json("genes.json.txt", function(error, json) { | |
if (error) return console.warn(error); | |
var genes = svg.selectAll(".genes") | |
.data(json) | |
.enter() | |
.append("g") | |
.attr("transform", "translate (300,300)"); | |
//outer circle | |
var r = 250 | |
var p = Math.PI *2; | |
var arc = d3.svg.arc() | |
.innerRadius(r-30) | |
.outerRadius(r) | |
.startAngle(0) | |
.endAngle(p) | |
genes.append("path") | |
.attr("d", arc) | |
.style({fill: "red"}) | |
.attr("stroke", "black"); | |
;}) | |
</script> | |
</body> |