This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
package biotools.ro1; | |
/** | |
* Created by hd on 9/9/14. | |
*/ | |
public class Gene { | |
private String geneA; | |
private String geneB; |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>HSBGPG Human gene for bone gla protein (BGP) | |
GGCAGATTCCCCCTAGACCCGCCCGCACCATGGTCAGGCATGCCCCTCCTCATCGCTGGGCACAGCCCAGAGGGT | |
ATAAACAGTGCTGGAGGCTGGCGGGGCAGGCCAGCTGAGTCCTGAGCAGCAGCCCAGCGCAGCCACCGAGACACC | |
ATGAGAGCCCTCACACTCCTCGCCCTATTGGCCCTGGCCGCACTTTGCATCGCTGGCCAGGCAGGTGAGTGCCCC | |
CACCTCCCCTCAGGCCGCATTGCAGTGGGGGCTGAGAGGAGGAAGCACCATGGCCCACCTCTTCTCACCCCTTTG | |
GCTGGCAGTCCCTTTGCAGTCTAACCACCTTGTTGCAGGCTCAATCCATTTGCCCCAGCTCTGCCCTTGCAGAGG | |
GAGAGGAGGGAAGAGCAAGCTGCCCGAGACGCAGGGGAAGGAGGATGAGGGCCCTGGGGATGAGCTGGGGTGAAC | |
CAGGCTCCCTTTCCTTTGCAGGTGCGAAGCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGGTATGAGGATGGACC | |
TGATGGGTTCCTGGACCCTCCCCTCTCACCCTGGTCCCTCAGTCTCATTCCCCCACTCCTGCCACCTCCTGTCTG | |
GCCATCAGGAAGGCCAGCCTGCTCCCCACCTGATCCTCCCAAACCCAGAGCCACCTGATGCCTGCCCCTCTGCTC |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
// We include what we need for the test | |
#include <gatb/gatb_core.hpp> | |
/********************************************************************************/ | |
/* Graph nodes iteration */ | |
/********************************************************************************/ | |
int main (int argc, char* argv[]) | |
{ | |
// We check that the user provides at least one option (supposed to be in HDF5 format). | |
if (argc < 2) | |
{ |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
int main(int argc, char* argv[]) { | |
BNLearner learner(argv[1]); | |
learner.useGreedyHillClimbing(); | |
gum::BayesNet<float> bn = learner.learnBN(); | |
cout << "Structure learning" << endl; | |
cout << "------------------" << endl; | |
const gum::Potential<float>& p1 = bn.cpt(bn.idFromName("lung_cancer?")); |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
int main(int argc, char* argv[]) { | |
namespace spd = spdlog; | |
try { | |
//Create console, multithreaded logger | |
auto console = spd::stdout_logger_mt("console"); | |
console->info("Bayesian Network Build"); | |
int k = atoi(argv[2]); |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/bin/sh | |
#SBATCH --time=24:00:00 # Run time in hh:mm:ss | |
#SBATCH --mem-per-cpu=16384 # Minimum memory required per CPU (in megabytes) | |
#SBATCH --job-name=bnp-bootstrap | |
#SBATCH --error=/work/otu/hdogan/job.%J.err | |
#SBATCH --output=/work/otu/hdogan/job.%J.out | |
Rscript bootstrap.R data.csv |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
library(bnlearn) | |
options(echo=TRUE) | |
args <- commandArgs(trailingOnly = TRUE) | |
print(args) | |
data <- read.table(args[1], sep = ",", header = TRUE) | |
col_names <- names(data) | |
data[, col_names] <- lapply(data[,col_names] , factor) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
###### S1400707GEM_1 | |
. | |
├── $RECYCLE.BIN | |
│ └── S-1-5-21-4038060156-87135356-2143169266-1001 | |
│ └── desktop.ini | |
├── Configuration.xml | |
├── Eclipse | |
│ └── workspace | |
│ └── snpAnnotationForBacteria | |
│ ├── SAM18146101_s_1.out-Variants-snpEff-test.txt |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
[0.000000] Reading FastQ file s_197_1_extracted_reads.fastq; | |
[392.937697] 24921054 sequences found | |
[392.937699] Done | |
[393.003596] Reading FastQ file s_197_2_extracted_reads.fastq; | |
[717.206876] 24921054 sequences found | |
[717.206878] Done | |
[717.206927] Reading read set file output_assemble//Sequences; | |
[726.800873] 49842108 sequences found | |
[784.617406] Done | |
[784.617411] 49842108 sequences in total. |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# views.py | |
# ======== | |
def add_file(request, project_id): | |
if request.method == 'POST': | |
form = VennCsvForm(request.POST, request.FILES) | |
if form.is_valid(): | |
new_file = VennCsv(file=request.FILES['file']) | |
new_file.user = request.user | |
new_file.project = get_object_or_404(VennProject, pk=project_id) | |
new_file.save() |
OlderNewer