Skip to content

Instantly share code, notes, and snippets.

@iimog
Created Jun 7, 2018
Embed
What would you like to do?
{
"conf": {
"circular": {
"tickSize": 5
},
"features": {
"fallbackStyle": {
"color": "#787878",
"form": "rect",
"height": 30,
"visible": false
},
"showAllFeatures": false,
"supportedFeatures": {}
},
"graphicalParameters": {
"buttonWidth": 90,
"canvasHeight": 900,
"canvasWidth": 900,
"fade": 0.1,
"genomeLabelWidth": 200,
"karyoDistance": 5000,
"karyoHeight": 30,
"linkKaryoDistance": 20,
"tickDistance": 100,
"tickLabelFrequency": 10,
"treeWidth": 200
},
"labels": {
"chromosome": {
"showChromosomeLabels": false
},
"features": {
"showFeatureLabels": false
},
"genome": {
"color": "#000000",
"showGenomeLabels": true,
"size": 25
},
"showAllLabels": false,
"ticks": {
"color": "#000000",
"showTickLabels": true,
"showTicks": true,
"size": 10
}
},
"layout": "linear",
"linear": {
"drawAllLinks": false,
"endLineColor": "#1d91c0",
"hideHalfVisibleLinks": false,
"startLineColor": "#1d91c0"
},
"maxLinkIdentity": 100,
"maxLinkIdentityColor": "#1DAD0A",
"maxLinkLength": 5000,
"midLinkIdentity": 85,
"midLinkIdentityColor": "#FFEE05",
"minLinkIdentity": 70,
"minLinkIdentityColor": "#D21414",
"minLinkLength": 100,
"offset": {
"distance": 1000,
"isSet": false
},
"tree": {
"drawTree": true,
"orientation": "left"
}
},
"data": {
"features": {
"link": {
"linkfeature000001": {
"end": 1,
"karyo": "seq0",
"start": 9573
},
"linkfeature000002": {
"end": 9573,
"karyo": "seq1",
"start": 1
}
}
},
"karyo": {
"chromosomes": {
"seq0": {
"genome_id": "seq0.fa",
"length": 9575,
"name": "seq0",
"seq": "TATGCCAGCTCGAGCTTCTTCTCACAGCGCAGGAGCATGCCATAGAGGTCACGAGGCTCGTCTGGATCTGCCAGCAAATCCAGCTCGGTAAACAAGGCGAATTCGGCAATCTTGCCGCGGACATAGCGCAAGGCCGAGAAGTCCTCGATTGCGAAGCCGACACTATCGAACAAGGTGATCTGCTTATCATTGCTTCGGCCGATCGCGTCGCCGGTCATAACCTGCCAAAGCTCAGTAACCGGATGCGACGCAGGAAGCTGCTGAATGTCGCCTTCGATCCAGGTCTGCGGTGGATACTCTATGAAGATGTCCGAGCGCAGCAGGACCTCTTTGCTGATCTCCGTCTTGCCGGGGCAATCGCCGCCTACAGCGTTGATATGAACACCTGGTCCGACATGATTGTCAGACACGATTGTTGCGTACTGTTTGTCGGCGGTGACAGTGGTGATGATGTCTGCGCCCTCAACGGCGTCGGCGACCGATTTGCATTCAACGATGTTGAAGCCAAGTCCGGTAAGATTGCGTGTGCATTTCCGCGTCGCAGCTGGATCAATGTCGTAGAGACGCAGTTCCTGGATTCCGAGGAGCGCTCTGAAGGCGCGAGCCTGGAACTCACTCTGGGCGCCGTTGCCGATGATGGCCATCGTTCGTGAGTTCGGTCGCGCCAGATATTTCGCGGCAAGAGCGGATGTCGCAGCAGTGCGAAGCGCGGTCAGTATCGTCATCTCCGAAAAAAGCAGCGGATAGCCGTTTCCGACATCGGCAAGGACACCGAAAGCGGTGACCGTCTGGCGGCCGTCCCGCGTGTTTTTCGGATGGCCGTTGACGTATTTGAAGCCGTAGAGTGCACCATCGCTGGTTGGCATCAGCTCGATGACGCCCTCGCTGGAGTGGGAGCCAACCCTGGGCGTCTTGTCAAAAATGGGCCAACGGCGAAAGTCTTCCTCGATCGCCGCTGCCAGTTCAGTGAGAAAGGTATCAATACCCACCTTGAGCACCAGTTTCATCATGTGATCCACGCTTACGAACGGAACCACGTTTAGCTTGCGATCGACGGTCATTATTCCTCCAGTCATTCGACGGTAGATTTCAGGCAGCGCGGGTTGGTCTATCCATGACCCGCTTGCCCATGAGACTTGCAACGATATCTACGATGAGCCGTGCGGTCTTCCCGCGCTCATCGAGAAAGGGGTTCAATTCGACGAGATCCAGGCTGGTGACGAGACCGCTGTCGTGAAGCATTTCCATGATCAGGTGCGCTTCGCGGAACGTCGCGCCGCCGGGGACAGTCGTTCCAACGGCGGGTGCAATTTCCGGATCGAGAAAGTCGACGTCGAAGCTGACATGCAACATCCCGTTCGCGGCGCGGACGCGCTCGAGGAACGTTCGGGTCACGCTGGCGACCCCGTGTTCATCGATGGCACGCATGTCATGCACGGTTATCGACGAGGACCGCAACGCGTCCCGCTCTGCGGGATCAACGCTCCTGATGCCGATCATGCATAAGTTTTCGGGCGGGACGGCGTGGTTCAGCGCTGGAAAGAAGCCCTCGAATCCACGCCGGCCAGTATAGTAGGCCACGGGCGTGCCATGCAGGTTTCCGCTGACGGTGGTTTCCAGCGTATGGAAATCGGTGTGGGCGTCAAGCCAGAGAACAAAGAGTTGGCGACCGTTCTCCGAGGCGCGCCGTGCAATTCCCGGGATCGTTCCTGCGGAGATCGTGTGATCGCCGCCAAGAAAGATCGGCACACTGTTATTGCTGTGTTCGTAAGCTGCCGCCGAAAGCAGCTTGATCCATGCCACCGTTTCACCGAGGTGATGGACGGAAGCGTTGGCATGGGCGATTGCCGGAACAGACTTCGAACCCAGATTGCCGAGGTCCCGAACCCTGTGCCCCAATTCTTCAAGCGCGCCGGCAAGACCGGCGATCCTGAACGCGCTCGGACCCATCTCGCAACCGAGATGTCCTGCCCCAATTTGCAGCGGTGCTCCGATCAATATGCATTCCATAACAATCTCCAGCAACGACTGCGATCTTGCAGCCGCCTCCAAGGCTTCGCCAGGTTCAGTAGTGAGCGGTGGCGATTAGCTCGATGAGCGTCGTGTCGCCGAGATCAGCGACGCCGATGGTCGCGCGGGCGGGCAACTCCGCCGGCGCGAACCATTCCTTCCAGACCGCATCCATTTGCGACTTCACGTTCATGTCGGTGATAAAGATCGTGGCGGAGAGCAGGTTTGCGCGTTCTGAGCCTGCCTCTTTGAGATATGCATCGAGCTTGGTCAGGACCTGACGGGTCTGCCCTTCCATGCCGAGGCTTTCATCGTCAGCGACGATCCCGCCGATGTAGGCGATGCCGTTATGCTTGACGACGCGATGCAATGTCGGCATCCGGATAAGTCGCTCTGTCATGAGAAATGTCCTGCTTCGTTGGTGTCATGATCGACAGGATCCCTGCCGGTTACCGCCTTCAGCGCGTGGGGCGTGTGCGGGAGATGTGCAAGTTCAGCAAGCCGAACGGGCTTGACTGGCGAACGAAGGCGATAGGTTCCCACTTCGCCGGGGCTGATCTTTCTTTCTTCCGCCATGATTTCTGTGACGGTCGCTGCACAAAGACGGCCCTGGCATTGGCCCATTCCGCAGCGAACAAATGTTTTCAACTGGTTCGGACCGGGCGGTCCAAGCGCAATGGCCTCCCGCAGCTTGCGCACTGTGATTTCTTCACAGCGGCAGACGATTGTTTCGGGGTTTGCCGGTGCGAGGAAGCCCGAACGGGGTGTGTAGAGAGCATCCAGAAACGCCCTTCCGCGCAGGAAGCGGCGGGCTTTCTTGTGCAGAGATTTGATCGGCGTAGGCACTGCCGTCGTACTGCCAAGCCCCAAGTCAGAAAGTGCCGCAAGTGCAACGATGCGTCCGCTGACCTCCGCGGCTTGAGCACCTGCGATCCCGGCTCCGTCGCCGGCGACATAAATGCCTGCCTTGGTGGTCCGACCTTCATGATCTGCGACAGGCTCGAACGCACGCTGTTCGTCATTCCATTTCAACTCACAGCCCGCTGCATTGGTCAGGCTCGTCGACGGAATCACCCCCTGGTGCAAGAGCACCGAGCTGGCAGGGAGGACTTGTTCGTTACCGGTTGTGGTGAAACGCACGCCTTCAGCGCGCTCGATGCCGGTGATCGCAATGGATCTGACGCCGGAAACCACGCGTGCATGACGTTTTACCTTCGCCAGCAAGCCTATGCCTTTCAACACGTAAGGTGAAAGCATGAATTCGGGCATGTGTCGGAGCACGCCGAGCCGGAAGGGAGATTGAGCAGTATCGAGCACGGTGAGATCAGATACGCCTGCATCGACGAGCTGACTTGCCAGCAGATAGAGAAGTGGTCCGCAACCAGCCATGACCACAGGTCCCGATGGCATCGCTCCGGCTGCCTTGAGGGCGATCTGAGCAGCGCCCGCGGTCATCACGCCTGGCAAGGTCCAGCCGGGCACCGGCATGGGACGCTCCTGTGCGCCGGTGGCAAGAACAACAGCCTCAGCTTCAATCATTCGGGCCGAGCCGGCCACGGTCACGCCGACGACATTGCGTGTCTGATCCGCCGTTTCGTCCCGGTTTTCCAGGCTCCAGACCGTGGCGCGTGGCGCATAATCGACGTTGCTGAGACCGAACGCTTCTGCGAGCGGCTTTCCCTTCCAATAGTCGGGACCGAGAAAGATTCTTTTGTCGGGACTGTTTCGTGTGATCTCGCGGTAGATCTGTCCGCCCGGACGGGGGTTTTCGTCCAGTACCGTAACGCGGGCACCAGCCGCAGACGCTTCGACAGCGGCCGCCATACCTGCAGGTCCCGCGCCGATGACGAGAAGGTCGTAAAAAGCCAGAAGGTCCGATGCTGTTGAGACTTCGCGAAGGCTCATGGGACTATCCCCTCTTCGCTTGTCGCGAGCTTCGGGAATGTGGGCGCGCCCATCTGGCTCATAACCGTCATCCCGTCTTCGACCTCGGTCAGACAAGCTTGACGATTCTGCACGCCATCCACGGTGACCAAACACTCGAAGCAAACGCCCATCAGGCAGTAGGGCGCGCGCGGGCTCTTGCTAACGACGGATTGCCGAACGTGGTCGATCCCCGCGGCCAGCACAGCGGTGGCGAGCATATCTCCCCGCTCAGCCTGGATGATCACGCCATCGAAGGTGAACTGGACGGGTTGCTCTATCCTATGCAGCCTGTTGAGCATGGAACCTCCGGGCGGAAAAGGCTGACAGATCGTCGTCAAGCTTACCCGCGGCAATCTGCGGTGCCACGATCAGTGCGTGATTGGCAGCCAAGGTTACGCCAGAATGGCAGGCGACGAGGAATGCACCCGGGTGGCGCTCGGAATGATCGTAAATGGGTATTCCATCCGCCGTTTTGACCCTGAAACCCGTCCAGCTGCGCAGGACGTTCAGATCAGAAAGGGCGGGGAAAATTCTTAAGGCCCGGCTGGCCAGCACGGCGCTGATTTCGGATGACGATGAGATTTTGGCGCTGTCGGTCTCTTCGCTATCGCCGATCATGATACCACCTTCGTCGGCCTGCCGCATTCCGGCAGAGAGGCACGGCAGGGCGGTCTGGCTCTTTTCCGTGACGAGGATCTGGCCCTTGCTACGCTTGAGCGGGCAAGACAGCCCGACCATTGGCGCCAGCCTCTCGTTTTCGAGGCCGGCGGCGAGAACGACCCGGCGTGAAAATATGGAAAACCCATCACCCTTGAGAATGAAGCCTTCAGTCTTTGGTTCGATGGTTTGAACATGATGGTTTGGACGATAGGTCACCCCTTTCTTTTCCATCGCTGCGTGAAGCGCGTGGAAGAGGCGAAGTGCATTCACGTGTCCGTCCGCAGCACAATAGATCGAGCCTACAACCTCCGCGCCGATACCCGGCACGCGGTCAAGCGTCTGCTGGCGATTCAATACCTCAAATTGCGGAGCTCGCCCGTTTGTTTCGAGCGCAATGCTTTCCATATCCTCGCGATTGACCTCGAGTTCCTCTTCAGAGAGTGCGAAGGTATATGCTCCGTCCTGTTGAAGACCGACGTCGATGCCGCTGTCGTCGAACAGGGCTTTTGCCATCGTCGGCCATCTCTTGGCGGACGCATCTGACCAAAGAGCGTAATGGGGCGCATGCAGCCCTTTACCCTGCACCCAGACCAGCGCGAAATTGGCGCGCGATGCACGCAGATCCAGATCCGCGCCGTCGAGGACGAGAGGCTTCGTTCCTGAGCGTGCTAGACCCCAGGCAATCGAGGCGCCGACCAGGCCGCCTCCGATAATGGTCATATCAACTTCGTACATCGTATCTCGGCGTTCTTGTTTATTCGCAGCACCGGGATACGGCGCGAACGCCGTATCCCCTGGAAGCGACCGATCAATGGGGGGTGACGTCCACCTTGAACCACTTCAACGAGAGCGTCTTGATGGTGCCGTCTTCGCTTGCCGCCTTGATGGCTGCGTCAAAATCAGCCTTGAGTGCGGTGTCTTCCTTGCGAAGGCCAACAGCGACCACGCCGAACTCGCCACCGGAGAAAAGCGGCCCGACGAGCTTCGCGCCCTTCATTTCCGGCTTTTCAATTGCCGCGGCGAGTACGGTTGCGTTTGCCAAAACAGCATCCAGTCGACCGCTCGTCAGGTCGAAGTTGTGCTCCTCGACGGACTTGTATTCCTTGATATCCACGGCACCCTTGAAATACTTGTCCAGGAAAGTCGATGCTGTGGTCGATCCCTGCACGCCGACCGAGGTGCCGTTCAGGAAGCTCGATATGTCGGCAATAGCCTTTTTGGCGGCATCTGCCTGGCTGTCGAGCGAATAGGTTTCGCCCGTGCCTGGCATGTCCGCCAGCTTGCTGTCACCCATGACGGCAAAACCGTTGATGCCTGCTGCGTACGGAGTCGAGAAGCCGATCACTTCCTGCCGTTTTGGGGTGATGCTCATGGCGGCCATGATCGCATCGTACTTTTTGCCGGTCAGCGACGGGATAATGCCATCCCAGTTCTGCGCGACGATCTGGCATTTCGCCTTCATCTTCTCGCACAGGGCGTTGGCGAGATCGATCTCGAAGCCGTCGAGCTTGCCGCCTGGTCCCGAAAAGTTCCAGGGCGCATACCCGCCCTCGGTCGCGATTGTAATCGACTTTTCCTGGGCTGCTGCCTGACCGGCAACAAGGAGAAGCGCTGCGCACAGAATAGTTTTGAGTTTCATAAGTTCACCTCTGTTCATTTGTTTCCTGGACACGCGAGCCGTGACGAATTGATCGTCAGTGGGATGTACCGCCGTCGCGCCGCAGGAATTGCCGGAAGCGATCCGTGCGGGGGTGGGCGAACATTTCGGACGAAAGGCCTTCTTCGGCGATGACACCTTGGTGCAAGAAGACTGTGCGCGATGAAACATCGCGGGCAAAATCCATTTCGTGAGTGACGATCAGCATGGTTCGGCCCTCGGCCGCCAGATCACGCATAACCTTTAGAACTTCACCGACGAGTTCCGGATCAAGAGCCGACGTGGGCTCATCAAACAGCATGACATCCGGTCGCATCGCCAGGGCACGGGCAATTGCTGCACGTTGCTGCTGGCCGCCGGACAGCTCGGATGGGTAGGCATCGCGCTTGGAGCCAATACCAACGCGCTCAAGCAATGCCTCAGCCTCATCGCGGCACGACTTCCGGTCACGGCCCTGAACATGCAAGGGCGCTTCCATAACATTCTGGAGTATCGTCAGGTGTGACCAGAGATTGAAGCCCTGGAAGACCATTGCGGCCCGCTCCCGGAGCCTGTTGACCTGCTTGATATCCTTTGGACGAGCGGGCCGGCCGGCTCGATGCTCCAGGGCAATCTCTTCGCCCATGATCGCAACGCTTCCGGCATTCGGGACTTCGAGCATATTGACGCATCGCAGAAGCGTCGACTTGCCAGAGCCCGACGAGCCGAGGATCGAGATCACTTCTCCCTCGTTGGCCGTCAGCGATACACCGTGGAGGACCTCCAGGTTACCGAAGTTTTTCCTGATGTCTGTCAGCTGAACAGCTGGGCGAGCAGGGTTAGGCATGGATTTCGCCTTTTCGATCGACGGGATCGGACGTGCGTCTCCCTTTGCGTCGCTCGGGCCACAAAGCCCATTCGAGCAACGTGAAGAGACGCGCAACGATGAAGTTGAGGATGAGGTAGATTGCGCCGGCACAGGCAAAAACCTCGACGGTGCGATAGCTTTCCGAGATCAGTTTCGCGGCAATTCCGGTGATTTCCATGATGGTGATGGTGGACGCGAGAGACGTCGACTTGACCATCAGGATCACTTCATTGCTGTAGCCTGGCAGCATCTGGCGTATCGCCTGCGGGATGACGATCCGCCGGAACAGTTTTACCCTGCCCATACCGCAGGCTTTGGCGGCTTCAATTTGACCTGCGGGCACGGAGAGCAGTCCGCCTCGCATGATTTCGGCACTGTAAGCAGCCGTATTCAATGCAAGCGCCGTCATCGCGCACCAATAGGCATCGCGCAGGAATGGCCAGATGAAACTATGCCGAAGCTCCGGAAACTGGCTGAGGCCATAGTAGATGATGTAGATCTGGACGAGGAGCGGCGTGCCGCGAAACGCGAAAATGTAGAACCGCGCTGGCAGATCAAGCCACCAGCGGCGCGACACACGCATCAGAGCCAATCCGAAAGCAAGGACCGTACCTGCCGCAACCGAAAAAACCGCGAGCTTGAGCGCGAGCGGAATACCGGCCAGCAAAGCAACGAAGGTCTGCCAGAGGAATGCGGGATCGAACGGCATCACACGCCCCTCCGCAATCCGCGCATTGAGCGCGCCTCAGCCAGGCGGAAAGCCTGTCCGGAGACAAAAGTAATAGACAGGTAGAGTGCTGCAGCAGTGAGATAGAAGCTGAACGGCTGGCGCGTCGACCCCGAACCGACCTGCGCCTGGCGCATCAGTTCGACAAGGCCGATCACCGAGATCAGTGCGGATTCCTTAAGAACCAGCTGCCAGACATTGCCAACACCCGGCAATGCATACCGAGCCGCCTGCGGAAGAACGATCCGGCGGAACAACAGGAAAGAACCCATGCCGTACGCTCGACCTGCCTCGACTTCTCCCTTGTGGAGCGCCAGAACCGCGCCGCGCAGTACCTGGGTTTGATAAGCTCCGGAAACAACGCCGATGGCAAGCGCGCCGATCAGAAACGACGGAGCTCCAACGAAACCGCTACTTCCGAAAAGTGAGGCAACACCGGAAATGACGGAGCTCGATCCGAAGTAAAACAGATAGATGATAAGCAGGTCCGGAATGCCACGAAGCGCTGTCGTGTAAGCGGATGCCGTTGCCTGAAGAGCGCGCGAGCTTGAAAAGCTTGCGGCGGCACCAAGGCAGCCGAAGACAAGGCCGATTGCGAAGCCGCTGAATGCCACGGCGACCGTCATCCCGGTCGCTTTGAGCATATCATAGCCCCAGCCGTCAGGGCCGAAGCCCATGAGTTGAAAATAATCCATATCGTTCCCTGCGCGCGACCGATTAGCCGCACGTCTGACCCCGGTTGGTCCGGAAGAGTTGTCATTTATGAGTTCAGGTTTACATTCGACCCGCATTAGGTCAAATTCATAATGGATAGGCGAGAATAAGCAGATGCTATGGTGAGGCTATGAACCTAAGGCAGGTTGAGGCATTTCGGGCCGTCATGTTGACTGGGCAGATGACAGCGGCAGCAGAGCTGATGTTGGTGACCCAGCCAGCCGTCAGCCGGCTTATCAAGGACTTCGAGCATGCAACCGGGCTTCATTTGTTCGAAAGGCGCGGAAACCACATAATTCCCACACAGGAGGCGACGACCCTCTGGAAAGAGGTCGACAGGGCATTCGTCGGGCTCAATCACATTGCCAACCTTGCGGCCGATATCGGCAGACAGGCGGCCGGCACCCTTCGCATAGCTGCGATGCCTGCTCTGGCGAACGGCCTTCTGCCACGGTTTCTCGCTCAGTTCCTGCATGACAAACCAAACCTGCAAGCGTCATTGACAGGCCTTCCTTCCACCATGGTCATGGAGGCTGTCGCTTCCGGCCGGGCCGACATTGGCTATGCCGACGGCCCTTCGGATCGTCCCGGCTTTCTTCTGGAAACCCGTTCGCTTGCTGCAATCGTTGCTGTTCCGATGGGACACAGGCTCGCCGGTCTCGAGCGGATAACTCCTCCGGACCTGGCTGGCGAACGGATCATAAAGCAGGAAACTGGCACACTCTTCGCCATGCGAGTTGACGTCGCTCTTGGCGGCATCCAACGGCGACCCTCTCTCGAAGTGAGCCTGTCGCATACGGCACTCAGTCTGGTCCGAGAAGGGGCGGGAATTGCAATAATCGATCCCGCCGCAGCCATCGAGTTCAAAGACAGGATTGTGCTGCGGCCTTTCTCGATTTTCATCGATGCAGGGTTCCTATTGGTACGTTCAAACAACGCAGCACCTTCGACCATAGTGGATCGTTTCGCGACCGAATTCTGGAGCTTCCACGATGACTTGATGTCACAAAACGGTCTGATGTGTTCGGCGTGAA"
},
"seq1": {
"genome_id": "seq1.fa",
"length": 9575,
"name": "seq1",
"seq": "CACGCCGAACACATCAGACCGTTTTGTGACATCAAGTCATCGTGGAAGCTCCAGAATTCGGTCGCGAAACGATCCACTATGGTCGAAGGTGCTGCGTTGTTTGAACGTACCAATAGGAACCCTGCATCGATGAAAATCGAGAAAGGCCGCAGCACAATCCTGTCTTTGAACTCGATGGCTGCGGCGGGATCGATTATTGCAATTCCCGCCCCTTCTCGGACCAGACTGAGTGCCGTATGCGACAGGCTCACTTCGAGAGAGGGTCGCCGTTGGATGCCGCCAAGAGCGACGTCAACTCGCATGGCGAAGAGTGTGCCAGTTTCCTGCTTTATGATCCGTTCGCCAGCCAGGTCCGGAGGAGTTATCCGCTCGAGACCGGCGAGCCTGTGTCCCATCGGAACAGCAACGATTGCAGCAAGCGAACGGGTTTCCAGAAGAAAGCCGGGACGATCCGAAGGGCCGTCGGCATAGCCAATGTCGGCCCGGCCGGAAGCGACAGCCTCCATGACCATGGTGGAAGGAAGGCCTGTCAATGACGCTTGCAGGTTTGGTTTGTCATGCAGGAACTGAGCGAGAAACCGTGGCAGAAGGCCGTTCGCCAGAGCAGGCATCGCAGCTATGCGAAGGGTGCCGGCCGCCTGTCTGCCGATATCGGCCGCAAGGTTGGCAATGTGATTGAGCCCGACGAATGCCCTGTCGACCTCTTTCCAGAGGGTCGTCGCCTCCTGTGTGGGAATTATGTGGTTTCCGCGCCTTTCGAACAAATGAAGCCCGGTTGCATGCTCGAAGTCCTTGATAAGCCGGCTGACGGCTGGCTGGGTCACCAACATCAGCTCTGCTGCCGCTGTCATCTGCCCAGTCAACATGACGGCCCGAAATGCCTCAACCTGCCTTAGGTTCATAGCCTCACCATAGCATCTGCTTATTCTCGCCTATCCATTATGAATTTGACCTAATGCGGGTCGAATGTAAACCTGAACTCATAAATGACAACTCTTCCGGACCAACCGGGGTCAGACGTGCGGCTAATCGGTCGCGCGCAGGGAACGATATGGATTATTTTCAACTCATGGGCTTCGGCCCTGACGGCTGGGGCTATGAAATGCTCAAAGCGACCGGGAGGACGGTCGCCGTGGCATTCAGCGGCTTCGCAATCGGCCTTGTCTTCGGCTGCCTTGGTGCCGCCGCAAGCTTTTCAAGCTCGCGCGCTCTTCAGGCAACGGCATCCGCTTACACGACAGCGCTTCGTGGCATTCCGGACCTGCTTATCATCTATCTGTTTTACTTCGGATCGAGCTCCGTCATTTCCGGTGTTGCCTCACTTTTCGGAAGTAGCGGTTTCGTTGGAGCTCCGTCGTTTCTGATCGGCGCGCTTGCCATCGGCGTTGTTTCCGGAGCTTATCAAACCCAGGTACTGCGCGGCGCGGTTCTGGCGCTCCACAAGGGAGAAGTCGAGGCAGGTCGAGCGTACGGCATGGGTTCTTTCCTGTTGTTCCGCCGGATCGTTCTTCCGCAGGCGGCTCGGTATGCATTGCCGGGTGTTGGCAATGTCTGGCAGCTGGTTCTTAAGGAATCCGCACTGATCTCGGTGATCGGCCTTGTCGAACTGATGCGCCAGGCGCAGGTCGGTTCGGGGTCGACGCGCCAGCCGTTCAGCTTCTATCTCACTGCTGCAGCACTCTACCTGTCTATTACTTTTGTCTCCGGACAGGCTTTCCGCCTGGCTGAGGCGCGCTCAATGCGCGGATTGCGGAGGGGCGTGTGATGCCGTTCGATCCCGCATTCCTCTGGCAGACCTTCGTTGCTTTGCTGGCCGGTATTCCGCTCGCGCTCAAGCTCGCGGTTTTTTCGGTTGCGGCAGGTACGGTCCTTGCTTTCGGATTGGCTCTGATGCGTGTGTCGCGCCGCTGGTGGCTTGATCTGCCAGCGCGGTTCTACATTTTCGCGTTTCGCGGCACGCCGCTCCTCGTCCAGATCTACATCATCTACTATGGCCTCAGCCAGTTTCCGGAGCTTCGGCATAGTTTCATCTGGCCATTCCTGCGCGATGCCTATTGGTGCGCGATGACGGCGCTTGCATTGAATACGGCTGCTTACAGTGCCGAAATCATGCGAGGCGGACTGCTCTCCGTGCCCGCAGGTCAAATTGAAGCCGCCAAAGCCTGCGGTATGGGCAGGGTAAAACTGTTCCGGCGGATCGTCATCCCGCAGGCGATACGCCAGATGCTGCCAGGCTACAGCAATGAAGTGATCCTGATGGTCAAGTCGACGTCTCTCGCGTCCACCATCACCATCATGGAAATCACCGGAATTGCCGCGAAACTGATCTCGGAAAGCTATCGCACCGTCGAGGTTTTTGCCTGTGCCGGCGCAATCTACCTCATCCTCAACTTCATCGTTGCGCGTCTCTTCACGTTGCTCGAATGGGCTTTGTGGCCCGAGCGACGCAAAGGGAGACGCACGTCCGATCCCGTCGATCGAAAAGGCGAAATCCATGCCTAACCCTGCTCGCCCAGCTGTTCAGCTGACAGACATCAGGAAAAACTTCGGTAACCTGGAGGTCCTCCACGGTGTATCGCTGACGGCCAACGAGGGAGAAGTGATCTCGATCCTCGGCTCGTCGGGCTCTGGCAAGTCGACGCTTCTGCGATGCGTCAATATGCTCGAAGTCCCGAATGCCGGAAGCGTTGCGATCATGGGCGAAGAGATTGCCCTGGAGCATCGAGCCGGCCGGCCCGCTCGTCCAAAGGATATCAAGCAGGTCAACAGGCTCCGGGAGCGGGCCGCAATGGTCTTCCAGGGCTTCAATCTCTGGTCACACCTGACGATACTCCAGAATGTTATGGAAGCGCCCTTGCATGTTCAGGGCCGTGACCGGAAGTCGTGCCGCGATGAGGCTGAGGCATTGCTTGAGCGCGTTGGTATTGGCTCCAAGCGCGATGCCTACCCATCCGAGCTGTCCGGCGGCCAGCAGCAACGTGCAGCAATTGCCCGTGCCCTGGCGATGCGACCGGATGTCATGCTGTTTGATGAGCCCACGTCGGCTCTTGATCCGGACCTCGTCGGTGAAGTTCTAAAGGTTATGCGTGATCTGGCGGCCGAGGGCCGAACCATGCTGATCGTCACTCACGAAATGGATTTTGCCCGCGATGTTTCATCGCGCACAGTCTTCTTGCACCAAGGTGTCATCGCCGAAGAAGGCCTTTCGTCCGAAATGTTCGCCCACCCCCGCACGGATCGCTTCCGGCAATTCCTGCGGCGCGACGGCGGTACATCCCACTGACGATCAATTCGTCACGGCTCGCGTGTCCAGGAAACAAATGAACAGAGGTGAACTTATGAAACTCAAAACTATTCTGTGCGCAGCGCTTCTCCTTGTTGCCGGTCAGGCAGCAGCCCAGGAAAAGTCGATTACAATCGCGACCGAGGGCGGGTATGCGCCCTGGAACTTTTCGGGACCAGGCGGCAAGCTCGACGGCTTCGAGATCGATCTCGCCAACGCCCTGTGCGAGAAGATGAAGGCGAAATGCCAGATCGTCGCGCAGAACTGGGATGGCATTATCCCGTCGCTGACCGGCAAAAAGTACGATGCGATCATGGCCGCCATGAGCATCACCCCAAAACGGCAGGAAGTGATCGGCTTCTCGACTCCGTACGCAGCAGGCATCAACGGTTTTGCCGTCATGGGTGACAGCAAGCTGGCGGACATGCCAGGCACGGGCGAAACCTATTCGCTCGACAGCCAGGCAGATGCCGCCAAAAAGGCTATTGCCGACATATCGAGCTTCCTGAACGGCACCTCGGTCGGCGTGCAGGGATCGACCACAGCATCGACTTTCCTGGACAAGTATTTCAAGGGTGCCGTGGATATCAAGGAATACAAGTCCGTCGAGGAGCACAACTTCGACCTGACGAGCGGTCGACTGGATGCTGTTTTGGCAAACGCAACCGTACTCGCCGCGGCAATTGAAAAGCCGGAAATGAAGGGCGCGAAGCTCGTCGGGCCGCTTTTCTCCGGTGGCGAGTTCGGCGTGGTCGCTGTTGGCCTTCGCAAGGAAGACACCGCACTCACGGCTGATTTTGACGCAGCCATCAAGGCGGCAAGCGAAGACGGCACCATCAAGACGCTCTCGTTGAAGTGGTTCAAGGTGGACGTCACCCCCCATTGATCGGTCGCTTCCAGGGGATACGGCGTTCGCGCCGTATCCCGGTGCTGCGAATAAACAAGACCGCCGAGATACGATGTACGAAGTTGATATGAGCATTATCGGAGGCGGCCTGGTCGGCGCCTCGATTGCCTGGGGTCTAGCACGCTCAGGAACGAAGCCTCTCGTCCTCGACGGCGCGGATCTGGATCTGCGTGCATCGCGCGCCAATTTCGCGCTGGTCTGGGTGCAGGGTAAAGGGCTGCATGCGCCCCATTACGCTCTTTGGTCAGATGCGTCCGCCAAGAGATGGCCGACGATGGCAAAAGCCCTGTTCGACGACAGCGGCATCGACGTCGGTCTTCAACAGGACGGAGCATATACCTTCGCACTCTCTGAAGAGGAACTCGAGGTCAATCGCGAGGATATGGAAAGCATTGCGCTCGAAACAAACGGGCGAGCTCCGCAATTTGAGGTATTGAATCGCCAGCAGACGCTTGACCGCGTGCCGGGTATCGGCGCGGAGGTTGTAGGCTCGATCTATTGTGCTGCGGACGGACACGTGAATGCACTTCGCCTCTTCCACGCGCTTCACGCAGCGATGGAAAAGAAAGGGGTGACCTATCGTCCAAACCATCATGTTCAAACCATCGAACCAAAGACTGAAGGCTTCATTCTCAAGGGTGATGGGTTTTCCATATTTTCACGCCGGGTCGTTCTCGCCGCCGGCCTCGAAAACGAGAGGCTGGCGCCAATGGTCGGGCTGTCTTGCCCGCTCAAGCGTAGCAAGGGCCAGATCCTCGTCACGGAAAAGAGCCAGACCGCCCTGCCGTGCCTCTCTGCCGGAATGCGGCAGGCCGACGAAGGTGGTATCATGATCGGCGATAGCGAAGAGACCGACAGCGCCAAAATCTCATCGTGATCCGAAATCAGCGCCGTGCTGGCCAGCCGGGCCTTAAGAATTTTCCCCGCCCTTTCTGATCTGAACGTCCTGCGCAGCTGGACGGGTTTCAGGGTCAAAACGGCGGATGGAATACCCATTTACGATCATTCCGAGCGCCACCCGGGTGCATTCCTCGTCGCCTGCCATTCTGGCGTAACCTTGGCTGCCAATCACGCACTCATCGTGGCACCGCAGATTGCCGCGGGTAAGCTTGACGACGATCTGTCAGCCTTTTCCGCCCGGAGGTTCCATGCTCATCAGGCTGCATAGGATAGAGCAACCCGTCCAGTTCACCTTCGATGGCGTGATCATCCAGGCTGAGCGGGGAGATATGCTCGCCACCGCTGTGCTTGCCGCGGGGATCGACCACGTTCGGCAATCCGTCGTTAGCAAGAGCCCGCGCGCGCCCTACTGCCTGATGGGCGTTTGCTTCGAGTGTTTGGTCACCGTGGATGGCGTGCAGAATCGTCAAGCTTGTCTGACCGAGGTCGAAGACGGGATGACGGTTATGAGCCAGATGGGCGCGCCCACATTCCCGAAGCTCGCGACAAGCGAAGAGGGGATAGTCCCATGAGCCTTCGCGAAGTCTCAACAGCATCGGACCTTCTGGCTTTTTACGACCTTCTCGTCATCGGCGCGGGACCTGCAGGTATGGCGGCCGCTGTCGAAGCGTCTGCGGCTGGTGCCCGCGTTACGGTACTGGACGAAAACCCCCGTCCGGGCGGACAGATCTACCGCGAGATCACACGAAACAGTCCCGACAAAAGAATCTTTCTCGGTCCCGACTATTGGAAGGGAAAGCCGCTCGCAGAAGCGTTCGGTCTCAGCAACGTCGATTATGCGCCACGCGCCACGGTCTGGAGCCTGGAAAACCGGGACGAAACGGCGGATCAGACACGCAATGTCGTCGGCGTGACCGTGGCCGGCTCGGCCCGAATGATTGAAGCTGAGGCTGTTGTTCTTGCCACCGGCGCACAGGAGCGTCCCATGCCGGTGCCCGGCTGGACCTTGCCAGGCGTGATGACCGCGGGCGCTGCTCAGATCGCCCTCAAGGCAGCCGGAGCGATGCCATCGGGACCTGTGGTCATGGCTGGTTGCGGACCACTTCTCTATCTGCTGGCAAGTCAGCTCGTCGATGCAGGCGTATCTGATCTCACCGTGCTCGATACTGCTCAATCTCCCTTCCGGCTCGGCGTGCTCCGACACATGCCCGAATTCATGCTTTCACCTTACGTGTTGAAAGGCATAGGCTTGCTGGCGAAGGTAAAACGTCATGCACGCGTGGTTTCCGGCGTCAGATCCATTGCGATCACCGGCATCGAGCGCGCTGAAGGCGTGCGTTTCACCACAACCGGTAACGAACAAGTCCTCCCTGCCAGCTCGGTGCTCTTGCACCAGGGGGTGATTCCGTCGACGAGCCTGACCAATGCAGCGGGCTGTGAGTTGAAATGGAATGACGAACAGCGTGCGTTCGAGCCTGTCGCAGATCATGAAGGTCGGACCACCAAGGCAGGCATTTATGTCGCCGGCGACGGAGCCGGGATCGCAGGTGCTCAAGCCGCGGAGGTCAGCGGACGCATCGTTGCACTTGCGGCACTTTCTGACTTGGGGCTTGGCAGTACGACGGCAGTGCCTACGCCGATCAAATCTCTGCACAAGAAAGCCCGCCGCTTCCTGCGCGGAAGGGCGTTTCTGGATGCTCTCTACACACCCCGTTCGGGCTTCCTCGCACCGGCAAACCCCGAAACAATCGTCTGCCGCTGTGAAGAAATCACAGTGCGCAAGCTGCGGGAGGCCATTGCGCTTGGACCGCCCGGTCCGAACCAGTTGAAAACATTTGTTCGCTGCGGAATGGGCCAATGCCAGGGCCGTCTTTGTGCAGCGACCGTCACAGAAATCATGGCGGAAGAAAGAAAGATCAGCCCCGGCGAAGTGGGAACCTATCGCCTTCGTTCGCCAGTCAAGCCCGTTCGGCTTGCTGAACTTGCACATCTCCCGCACACGCCCCACGCGCTGAAGGCGGTAACCGGCAGGGATCCTGTCGATCATGACACCAACGAAGCAGGACATTTCTCATGACAGAGCGACTTATCCGGATGCCGACATTGCATCGCGTCGTCAAGCATAACGGCATCGCCTACATCGGCGGGATCGTCGCTGACGATGAAAGCCTCGGCATGGAAGGGCAGACCCGTCAGGTCCTGACCAAGCTCGATGCATATCTCAAAGAGGCAGGCTCAGAACGCGCAAACCTGCTCTCCGCCACGATCTTTATCACCGACATGAACGTGAAGTCGCAAATGGATGCGGTCTGGAAGGAATGGTTCGCGCCGGCGGAGTTGCCCGCCCGCGCGACCATCGGCGTCGCTGATCTCGGCGACACGACGCTCATCGAGCTAATCGCCACCGCTCACTACTGAACCTGGCGAAGCCTTGGAGGCGGCTGCAAGATCGCAGTCGTTGCTGGAGATTGTTATGGAATGCATATTGATCGGAGCACCGCTGCAAATTGGGGCAGGACATCTCGGTTGCGAGATGGGTCCGAGCGCGTTCAGGATCGCCGGTCTTGCCGGCGCGCTTGAAGAATTGGGGCACAGGGTTCGGGACCTCGGCAATCTGGGTTCGAAGTCTGTTCCGGCAATCGCCCATGCCAACGCTTCCGTCCATCACCTCGGTGAAACGGTGGCATGGATCAAGCTGCTTTCGGCGGCAGCTTACGAACACAGCAATAACAGTGTGCCGATCTTTCTTGGCGGCGATCACACGATCTCCGCAGGAACGATCCCGGGAATTGCACGGCGCGCCTCGGAGAACGGTCGCCAACTCTTTGTTCTCTGGCTTGACGCCCACACCGATTTCCATACGCTGGAAACCACCGTCAGCGGAAACCTGCATGGCACGCCCGTGGCCTACTATACTGGCCGGCGTGGATTCGAGGGCTTCTTTCCAGCGCTGAACCACGCCGTCCCGCCCGAAAACTTATGCATGATCGGCATCAGGAGCGTTGATCCCGCAGAGCGGGACGCGTTGCGGTCCTCGTCGATAACCGTGCATGACATGCGTGCCATCGATGAACACGGGGTCGCCAGCGTGACCCGAACGTTCCTCGAGCGCGTCCGCGCCGCGAACGGGATGTTGCATGTCAGCTTCGACGTCGACTTTCTCGATCCGGAAATTGCACCCGCCGTTGGAACGACTGTCCCCGGCGGCGCGACGTTCCGCGAAGCGCACCTGATCATGGAAATGCTTCACGACAGCGGTCTCGTCACCAGCCTGGATCTCGTCGAATTGAACCCCTTTCTCGATGAGCGCGGGAAGACCGCACGGCTCATCGTAGATATCGTTGCAAGTCTCATGGGCAAGCGGGTCATGGATAGACCAACCCGCGCTGCCTGAAATCTACCGTCGAATGACTGGAGGAATAATGACCGTCGATCGCAAGCTAAACGTGGTTCCGTTCGTAAGCGTGGATCACATGATGAAACTGGTGCTCAAGGTGGGTATTGATACCTTTCTCACTGAACTGGCAGCGGCGATCGAGGAAGACTTTCGCCGTTGGCCCATTTTTGACAAGACGCCCAGGGTTGGCTCCCACTCCAGCGAGGGCGTCATCGAGCTGATGCCAACCAGCGATGGTGCACTCTACGGCTTCAAATACGTCAACGGCCATCCGAAAAACACGCGGGACGGCCGCCAGACGGTCACCGCTTTCGGTGTCCTTGCCGATGTCGGAAACGGCTATCCGCTGCTTTTTTCGGAGATGACGATACTGACCGCGCTTCGCACTGCTGCGACATCCGCTCTTGCCGCGAAATATCTGGCGCGACCGAACTCACGAACGATGGCCATCATCGGCAACGGCGCCCAGAGTGAGTTCCAGGCTCGCGCCTTCAGAGCGCTCCTCGGAATCCAGGAACTGCGTCTCTACGACATTGATCCAGCTGCGACGCGGAAATGCACACGCAATCTTACCGGACTTGGCTTCAACATCGTTGAATGCAAATCGGTCGCCGACGCCGTTGAGGGCGCAGACATCATCACCACTGTCACCGCCGACAAACAGTACGCAACAATCGTGTCTGACAATCATGTCGGACCAGGTGTTCATATCAACGCTGTAGGCGGCGATTGCCCCGGCAAGACGGAGATCAGCAAAGAGGTCCTGCTGCGCTCGGACATCTTCATAGAGTATCCACCGCAGACCTGGATCGAAGGCGACATTCAGCAGCTTCCTGCGTCGCATCCGGTTACTGAGCTTTGGCAGGTTATGACCGGCGACGCGATCGGCCGAAGCAATGATAAGCAGATCACCTTGTTCGATAGTGTCGGCTTCGCAATCGAGGACTTCTCGGCCTTGCGCTATGTCCGCGGCAAGATTGCCGAATTCGCCTTGTTTACCGAGCTGGATTTGCTGGCAGATCCAGACGAGCCTCGTGACCTCTATGGCATGCTCCTGCGCTGTGAGAAGAAGCTCGAGCTGGCATAGG"
}
}
},
"links": {
"seq0.fa": {
"seq1.fa": {
"link000001": {
"identity": 99.9,
"source": "linkfeature000001",
"target": "linkfeature000002"
}
}
}
},
"tree": null
},
"filters": {
"features": {
"invisibleFeatures": {}
},
"karyo": {
"chromosomes": {
"seq0": {
"reverse": false,
"visible": true
},
"seq1": {
"reverse": false,
"visible": true
}
},
"genome_order": [
"seq0.fa",
"seq1.fa"
],
"order": [
"seq0",
"seq1"
]
},
"links": {
"invisibleLinks": {},
"maxLinkIdentity": 99.8955395382848,
"maxLinkLength": 9573,
"minLinkIdentity": 99.8955395382848,
"minLinkLength": 9573
},
"onlyShowAdjacentLinks": true,
"showAllChromosomes": false,
"showIntraGenomeLinks": false,
"skipChromosomesWithoutLinks": false,
"skipChromosomesWithoutVisibleLinks": false
}
}
>seq0
TATGCCAGCTCGAGCTTCTTCTCACAGCGCAGGAGCATGCCATAGAGGTCACGAGGCTCGTCTGGATCTGCCAGCAAATC
CAGCTCGGTAAACAAGGCGAATTCGGCAATCTTGCCGCGGACATAGCGCAAGGCCGAGAAGTCCTCGATTGCGAAGCCGA
CACTATCGAACAAGGTGATCTGCTTATCATTGCTTCGGCCGATCGCGTCGCCGGTCATAACCTGCCAAAGCTCAGTAACC
GGATGCGACGCAGGAAGCTGCTGAATGTCGCCTTCGATCCAGGTCTGCGGTGGATACTCTATGAAGATGTCCGAGCGCAG
CAGGACCTCTTTGCTGATCTCCGTCTTGCCGGGGCAATCGCCGCCTACAGCGTTGATATGAACACCTGGTCCGACATGAT
TGTCAGACACGATTGTTGCGTACTGTTTGTCGGCGGTGACAGTGGTGATGATGTCTGCGCCCTCAACGGCGTCGGCGACC
GATTTGCATTCAACGATGTTGAAGCCAAGTCCGGTAAGATTGCGTGTGCATTTCCGCGTCGCAGCTGGATCAATGTCGTA
GAGACGCAGTTCCTGGATTCCGAGGAGCGCTCTGAAGGCGCGAGCCTGGAACTCACTCTGGGCGCCGTTGCCGATGATGG
CCATCGTTCGTGAGTTCGGTCGCGCCAGATATTTCGCGGCAAGAGCGGATGTCGCAGCAGTGCGAAGCGCGGTCAGTATC
GTCATCTCCGAAAAAAGCAGCGGATAGCCGTTTCCGACATCGGCAAGGACACCGAAAGCGGTGACCGTCTGGCGGCCGTC
CCGCGTGTTTTTCGGATGGCCGTTGACGTATTTGAAGCCGTAGAGTGCACCATCGCTGGTTGGCATCAGCTCGATGACGC
CCTCGCTGGAGTGGGAGCCAACCCTGGGCGTCTTGTCAAAAATGGGCCAACGGCGAAAGTCTTCCTCGATCGCCGCTGCC
AGTTCAGTGAGAAAGGTATCAATACCCACCTTGAGCACCAGTTTCATCATGTGATCCACGCTTACGAACGGAACCACGTT
TAGCTTGCGATCGACGGTCATTATTCCTCCAGTCATTCGACGGTAGATTTCAGGCAGCGCGGGTTGGTCTATCCATGACC
CGCTTGCCCATGAGACTTGCAACGATATCTACGATGAGCCGTGCGGTCTTCCCGCGCTCATCGAGAAAGGGGTTCAATTC
GACGAGATCCAGGCTGGTGACGAGACCGCTGTCGTGAAGCATTTCCATGATCAGGTGCGCTTCGCGGAACGTCGCGCCGC
CGGGGACAGTCGTTCCAACGGCGGGTGCAATTTCCGGATCGAGAAAGTCGACGTCGAAGCTGACATGCAACATCCCGTTC
GCGGCGCGGACGCGCTCGAGGAACGTTCGGGTCACGCTGGCGACCCCGTGTTCATCGATGGCACGCATGTCATGCACGGT
TATCGACGAGGACCGCAACGCGTCCCGCTCTGCGGGATCAACGCTCCTGATGCCGATCATGCATAAGTTTTCGGGCGGGA
CGGCGTGGTTCAGCGCTGGAAAGAAGCCCTCGAATCCACGCCGGCCAGTATAGTAGGCCACGGGCGTGCCATGCAGGTTT
CCGCTGACGGTGGTTTCCAGCGTATGGAAATCGGTGTGGGCGTCAAGCCAGAGAACAAAGAGTTGGCGACCGTTCTCCGA
GGCGCGCCGTGCAATTCCCGGGATCGTTCCTGCGGAGATCGTGTGATCGCCGCCAAGAAAGATCGGCACACTGTTATTGC
TGTGTTCGTAAGCTGCCGCCGAAAGCAGCTTGATCCATGCCACCGTTTCACCGAGGTGATGGACGGAAGCGTTGGCATGG
GCGATTGCCGGAACAGACTTCGAACCCAGATTGCCGAGGTCCCGAACCCTGTGCCCCAATTCTTCAAGCGCGCCGGCAAG
ACCGGCGATCCTGAACGCGCTCGGACCCATCTCGCAACCGAGATGTCCTGCCCCAATTTGCAGCGGTGCTCCGATCAATA
TGCATTCCATAACAATCTCCAGCAACGACTGCGATCTTGCAGCCGCCTCCAAGGCTTCGCCAGGTTCAGTAGTGAGCGGT
GGCGATTAGCTCGATGAGCGTCGTGTCGCCGAGATCAGCGACGCCGATGGTCGCGCGGGCGGGCAACTCCGCCGGCGCGA
ACCATTCCTTCCAGACCGCATCCATTTGCGACTTCACGTTCATGTCGGTGATAAAGATCGTGGCGGAGAGCAGGTTTGCG
CGTTCTGAGCCTGCCTCTTTGAGATATGCATCGAGCTTGGTCAGGACCTGACGGGTCTGCCCTTCCATGCCGAGGCTTTC
ATCGTCAGCGACGATCCCGCCGATGTAGGCGATGCCGTTATGCTTGACGACGCGATGCAATGTCGGCATCCGGATAAGTC
GCTCTGTCATGAGAAATGTCCTGCTTCGTTGGTGTCATGATCGACAGGATCCCTGCCGGTTACCGCCTTCAGCGCGTGGG
GCGTGTGCGGGAGATGTGCAAGTTCAGCAAGCCGAACGGGCTTGACTGGCGAACGAAGGCGATAGGTTCCCACTTCGCCG
GGGCTGATCTTTCTTTCTTCCGCCATGATTTCTGTGACGGTCGCTGCACAAAGACGGCCCTGGCATTGGCCCATTCCGCA
GCGAACAAATGTTTTCAACTGGTTCGGACCGGGCGGTCCAAGCGCAATGGCCTCCCGCAGCTTGCGCACTGTGATTTCTT
CACAGCGGCAGACGATTGTTTCGGGGTTTGCCGGTGCGAGGAAGCCCGAACGGGGTGTGTAGAGAGCATCCAGAAACGCC
CTTCCGCGCAGGAAGCGGCGGGCTTTCTTGTGCAGAGATTTGATCGGCGTAGGCACTGCCGTCGTACTGCCAAGCCCCAA
GTCAGAAAGTGCCGCAAGTGCAACGATGCGTCCGCTGACCTCCGCGGCTTGAGCACCTGCGATCCCGGCTCCGTCGCCGG
CGACATAAATGCCTGCCTTGGTGGTCCGACCTTCATGATCTGCGACAGGCTCGAACGCACGCTGTTCGTCATTCCATTTC
AACTCACAGCCCGCTGCATTGGTCAGGCTCGTCGACGGAATCACCCCCTGGTGCAAGAGCACCGAGCTGGCAGGGAGGAC
TTGTTCGTTACCGGTTGTGGTGAAACGCACGCCTTCAGCGCGCTCGATGCCGGTGATCGCAATGGATCTGACGCCGGAAA
CCACGCGTGCATGACGTTTTACCTTCGCCAGCAAGCCTATGCCTTTCAACACGTAAGGTGAAAGCATGAATTCGGGCATG
TGTCGGAGCACGCCGAGCCGGAAGGGAGATTGAGCAGTATCGAGCACGGTGAGATCAGATACGCCTGCATCGACGAGCTG
ACTTGCCAGCAGATAGAGAAGTGGTCCGCAACCAGCCATGACCACAGGTCCCGATGGCATCGCTCCGGCTGCCTTGAGGG
CGATCTGAGCAGCGCCCGCGGTCATCACGCCTGGCAAGGTCCAGCCGGGCACCGGCATGGGACGCTCCTGTGCGCCGGTG
GCAAGAACAACAGCCTCAGCTTCAATCATTCGGGCCGAGCCGGCCACGGTCACGCCGACGACATTGCGTGTCTGATCCGC
CGTTTCGTCCCGGTTTTCCAGGCTCCAGACCGTGGCGCGTGGCGCATAATCGACGTTGCTGAGACCGAACGCTTCTGCGA
GCGGCTTTCCCTTCCAATAGTCGGGACCGAGAAAGATTCTTTTGTCGGGACTGTTTCGTGTGATCTCGCGGTAGATCTGT
CCGCCCGGACGGGGGTTTTCGTCCAGTACCGTAACGCGGGCACCAGCCGCAGACGCTTCGACAGCGGCCGCCATACCTGC
AGGTCCCGCGCCGATGACGAGAAGGTCGTAAAAAGCCAGAAGGTCCGATGCTGTTGAGACTTCGCGAAGGCTCATGGGAC
TATCCCCTCTTCGCTTGTCGCGAGCTTCGGGAATGTGGGCGCGCCCATCTGGCTCATAACCGTCATCCCGTCTTCGACCT
CGGTCAGACAAGCTTGACGATTCTGCACGCCATCCACGGTGACCAAACACTCGAAGCAAACGCCCATCAGGCAGTAGGGC
GCGCGCGGGCTCTTGCTAACGACGGATTGCCGAACGTGGTCGATCCCCGCGGCCAGCACAGCGGTGGCGAGCATATCTCC
CCGCTCAGCCTGGATGATCACGCCATCGAAGGTGAACTGGACGGGTTGCTCTATCCTATGCAGCCTGTTGAGCATGGAAC
CTCCGGGCGGAAAAGGCTGACAGATCGTCGTCAAGCTTACCCGCGGCAATCTGCGGTGCCACGATCAGTGCGTGATTGGC
AGCCAAGGTTACGCCAGAATGGCAGGCGACGAGGAATGCACCCGGGTGGCGCTCGGAATGATCGTAAATGGGTATTCCAT
CCGCCGTTTTGACCCTGAAACCCGTCCAGCTGCGCAGGACGTTCAGATCAGAAAGGGCGGGGAAAATTCTTAAGGCCCGG
CTGGCCAGCACGGCGCTGATTTCGGATGACGATGAGATTTTGGCGCTGTCGGTCTCTTCGCTATCGCCGATCATGATACC
ACCTTCGTCGGCCTGCCGCATTCCGGCAGAGAGGCACGGCAGGGCGGTCTGGCTCTTTTCCGTGACGAGGATCTGGCCCT
TGCTACGCTTGAGCGGGCAAGACAGCCCGACCATTGGCGCCAGCCTCTCGTTTTCGAGGCCGGCGGCGAGAACGACCCGG
CGTGAAAATATGGAAAACCCATCACCCTTGAGAATGAAGCCTTCAGTCTTTGGTTCGATGGTTTGAACATGATGGTTTGG
ACGATAGGTCACCCCTTTCTTTTCCATCGCTGCGTGAAGCGCGTGGAAGAGGCGAAGTGCATTCACGTGTCCGTCCGCAG
CACAATAGATCGAGCCTACAACCTCCGCGCCGATACCCGGCACGCGGTCAAGCGTCTGCTGGCGATTCAATACCTCAAAT
TGCGGAGCTCGCCCGTTTGTTTCGAGCGCAATGCTTTCCATATCCTCGCGATTGACCTCGAGTTCCTCTTCAGAGAGTGC
GAAGGTATATGCTCCGTCCTGTTGAAGACCGACGTCGATGCCGCTGTCGTCGAACAGGGCTTTTGCCATCGTCGGCCATC
TCTTGGCGGACGCATCTGACCAAAGAGCGTAATGGGGCGCATGCAGCCCTTTACCCTGCACCCAGACCAGCGCGAAATTG
GCGCGCGATGCACGCAGATCCAGATCCGCGCCGTCGAGGACGAGAGGCTTCGTTCCTGAGCGTGCTAGACCCCAGGCAAT
CGAGGCGCCGACCAGGCCGCCTCCGATAATGGTCATATCAACTTCGTACATCGTATCTCGGCGTTCTTGTTTATTCGCAG
CACCGGGATACGGCGCGAACGCCGTATCCCCTGGAAGCGACCGATCAATGGGGGGTGACGTCCACCTTGAACCACTTCAA
CGAGAGCGTCTTGATGGTGCCGTCTTCGCTTGCCGCCTTGATGGCTGCGTCAAAATCAGCCTTGAGTGCGGTGTCTTCCT
TGCGAAGGCCAACAGCGACCACGCCGAACTCGCCACCGGAGAAAAGCGGCCCGACGAGCTTCGCGCCCTTCATTTCCGGC
TTTTCAATTGCCGCGGCGAGTACGGTTGCGTTTGCCAAAACAGCATCCAGTCGACCGCTCGTCAGGTCGAAGTTGTGCTC
CTCGACGGACTTGTATTCCTTGATATCCACGGCACCCTTGAAATACTTGTCCAGGAAAGTCGATGCTGTGGTCGATCCCT
GCACGCCGACCGAGGTGCCGTTCAGGAAGCTCGATATGTCGGCAATAGCCTTTTTGGCGGCATCTGCCTGGCTGTCGAGC
GAATAGGTTTCGCCCGTGCCTGGCATGTCCGCCAGCTTGCTGTCACCCATGACGGCAAAACCGTTGATGCCTGCTGCGTA
CGGAGTCGAGAAGCCGATCACTTCCTGCCGTTTTGGGGTGATGCTCATGGCGGCCATGATCGCATCGTACTTTTTGCCGG
TCAGCGACGGGATAATGCCATCCCAGTTCTGCGCGACGATCTGGCATTTCGCCTTCATCTTCTCGCACAGGGCGTTGGCG
AGATCGATCTCGAAGCCGTCGAGCTTGCCGCCTGGTCCCGAAAAGTTCCAGGGCGCATACCCGCCCTCGGTCGCGATTGT
AATCGACTTTTCCTGGGCTGCTGCCTGACCGGCAACAAGGAGAAGCGCTGCGCACAGAATAGTTTTGAGTTTCATAAGTT
CACCTCTGTTCATTTGTTTCCTGGACACGCGAGCCGTGACGAATTGATCGTCAGTGGGATGTACCGCCGTCGCGCCGCAG
GAATTGCCGGAAGCGATCCGTGCGGGGGTGGGCGAACATTTCGGACGAAAGGCCTTCTTCGGCGATGACACCTTGGTGCA
AGAAGACTGTGCGCGATGAAACATCGCGGGCAAAATCCATTTCGTGAGTGACGATCAGCATGGTTCGGCCCTCGGCCGCC
AGATCACGCATAACCTTTAGAACTTCACCGACGAGTTCCGGATCAAGAGCCGACGTGGGCTCATCAAACAGCATGACATC
CGGTCGCATCGCCAGGGCACGGGCAATTGCTGCACGTTGCTGCTGGCCGCCGGACAGCTCGGATGGGTAGGCATCGCGCT
TGGAGCCAATACCAACGCGCTCAAGCAATGCCTCAGCCTCATCGCGGCACGACTTCCGGTCACGGCCCTGAACATGCAAG
GGCGCTTCCATAACATTCTGGAGTATCGTCAGGTGTGACCAGAGATTGAAGCCCTGGAAGACCATTGCGGCCCGCTCCCG
GAGCCTGTTGACCTGCTTGATATCCTTTGGACGAGCGGGCCGGCCGGCTCGATGCTCCAGGGCAATCTCTTCGCCCATGA
TCGCAACGCTTCCGGCATTCGGGACTTCGAGCATATTGACGCATCGCAGAAGCGTCGACTTGCCAGAGCCCGACGAGCCG
AGGATCGAGATCACTTCTCCCTCGTTGGCCGTCAGCGATACACCGTGGAGGACCTCCAGGTTACCGAAGTTTTTCCTGAT
GTCTGTCAGCTGAACAGCTGGGCGAGCAGGGTTAGGCATGGATTTCGCCTTTTCGATCGACGGGATCGGACGTGCGTCTC
CCTTTGCGTCGCTCGGGCCACAAAGCCCATTCGAGCAACGTGAAGAGACGCGCAACGATGAAGTTGAGGATGAGGTAGAT
TGCGCCGGCACAGGCAAAAACCTCGACGGTGCGATAGCTTTCCGAGATCAGTTTCGCGGCAATTCCGGTGATTTCCATGA
TGGTGATGGTGGACGCGAGAGACGTCGACTTGACCATCAGGATCACTTCATTGCTGTAGCCTGGCAGCATCTGGCGTATC
GCCTGCGGGATGACGATCCGCCGGAACAGTTTTACCCTGCCCATACCGCAGGCTTTGGCGGCTTCAATTTGACCTGCGGG
CACGGAGAGCAGTCCGCCTCGCATGATTTCGGCACTGTAAGCAGCCGTATTCAATGCAAGCGCCGTCATCGCGCACCAAT
AGGCATCGCGCAGGAATGGCCAGATGAAACTATGCCGAAGCTCCGGAAACTGGCTGAGGCCATAGTAGATGATGTAGATC
TGGACGAGGAGCGGCGTGCCGCGAAACGCGAAAATGTAGAACCGCGCTGGCAGATCAAGCCACCAGCGGCGCGACACACG
CATCAGAGCCAATCCGAAAGCAAGGACCGTACCTGCCGCAACCGAAAAAACCGCGAGCTTGAGCGCGAGCGGAATACCGG
CCAGCAAAGCAACGAAGGTCTGCCAGAGGAATGCGGGATCGAACGGCATCACACGCCCCTCCGCAATCCGCGCATTGAGC
GCGCCTCAGCCAGGCGGAAAGCCTGTCCGGAGACAAAAGTAATAGACAGGTAGAGTGCTGCAGCAGTGAGATAGAAGCTG
AACGGCTGGCGCGTCGACCCCGAACCGACCTGCGCCTGGCGCATCAGTTCGACAAGGCCGATCACCGAGATCAGTGCGGA
TTCCTTAAGAACCAGCTGCCAGACATTGCCAACACCCGGCAATGCATACCGAGCCGCCTGCGGAAGAACGATCCGGCGGA
ACAACAGGAAAGAACCCATGCCGTACGCTCGACCTGCCTCGACTTCTCCCTTGTGGAGCGCCAGAACCGCGCCGCGCAGT
ACCTGGGTTTGATAAGCTCCGGAAACAACGCCGATGGCAAGCGCGCCGATCAGAAACGACGGAGCTCCAACGAAACCGCT
ACTTCCGAAAAGTGAGGCAACACCGGAAATGACGGAGCTCGATCCGAAGTAAAACAGATAGATGATAAGCAGGTCCGGAA
TGCCACGAAGCGCTGTCGTGTAAGCGGATGCCGTTGCCTGAAGAGCGCGCGAGCTTGAAAAGCTTGCGGCGGCACCAAGG
CAGCCGAAGACAAGGCCGATTGCGAAGCCGCTGAATGCCACGGCGACCGTCATCCCGGTCGCTTTGAGCATATCATAGCC
CCAGCCGTCAGGGCCGAAGCCCATGAGTTGAAAATAATCCATATCGTTCCCTGCGCGCGACCGATTAGCCGCACGTCTGA
CCCCGGTTGGTCCGGAAGAGTTGTCATTTATGAGTTCAGGTTTACATTCGACCCGCATTAGGTCAAATTCATAATGGATA
GGCGAGAATAAGCAGATGCTATGGTGAGGCTATGAACCTAAGGCAGGTTGAGGCATTTCGGGCCGTCATGTTGACTGGGC
AGATGACAGCGGCAGCAGAGCTGATGTTGGTGACCCAGCCAGCCGTCAGCCGGCTTATCAAGGACTTCGAGCATGCAACC
GGGCTTCATTTGTTCGAAAGGCGCGGAAACCACATAATTCCCACACAGGAGGCGACGACCCTCTGGAAAGAGGTCGACAG
GGCATTCGTCGGGCTCAATCACATTGCCAACCTTGCGGCCGATATCGGCAGACAGGCGGCCGGCACCCTTCGCATAGCTG
CGATGCCTGCTCTGGCGAACGGCCTTCTGCCACGGTTTCTCGCTCAGTTCCTGCATGACAAACCAAACCTGCAAGCGTCA
TTGACAGGCCTTCCTTCCACCATGGTCATGGAGGCTGTCGCTTCCGGCCGGGCCGACATTGGCTATGCCGACGGCCCTTC
GGATCGTCCCGGCTTTCTTCTGGAAACCCGTTCGCTTGCTGCAATCGTTGCTGTTCCGATGGGACACAGGCTCGCCGGTC
TCGAGCGGATAACTCCTCCGGACCTGGCTGGCGAACGGATCATAAAGCAGGAAACTGGCACACTCTTCGCCATGCGAGTT
GACGTCGCTCTTGGCGGCATCCAACGGCGACCCTCTCTCGAAGTGAGCCTGTCGCATACGGCACTCAGTCTGGTCCGAGA
AGGGGCGGGAATTGCAATAATCGATCCCGCCGCAGCCATCGAGTTCAAAGACAGGATTGTGCTGCGGCCTTTCTCGATTT
TCATCGATGCAGGGTTCCTATTGGTACGTTCAAACAACGCAGCACCTTCGACCATAGTGGATCGTTTCGCGACCGAATTC
TGGAGCTTCCACGATGACTTGATGTCACAAAACGGTCTGATGTGTTCGGCGTGAA
>seq1
CACGCCGAACACATCAGACCGTTTTGTGACATCAAGTCATCGTGGAAGCTCCAGAATTCGGTCGCGAAACGATCCACTAT
GGTCGAAGGTGCTGCGTTGTTTGAACGTACCAATAGGAACCCTGCATCGATGAAAATCGAGAAAGGCCGCAGCACAATCC
TGTCTTTGAACTCGATGGCTGCGGCGGGATCGATTATTGCAATTCCCGCCCCTTCTCGGACCAGACTGAGTGCCGTATGC
GACAGGCTCACTTCGAGAGAGGGTCGCCGTTGGATGCCGCCAAGAGCGACGTCAACTCGCATGGCGAAGAGTGTGCCAGT
TTCCTGCTTTATGATCCGTTCGCCAGCCAGGTCCGGAGGAGTTATCCGCTCGAGACCGGCGAGCCTGTGTCCCATCGGAA
CAGCAACGATTGCAGCAAGCGAACGGGTTTCCAGAAGAAAGCCGGGACGATCCGAAGGGCCGTCGGCATAGCCAATGTCG
GCCCGGCCGGAAGCGACAGCCTCCATGACCATGGTGGAAGGAAGGCCTGTCAATGACGCTTGCAGGTTTGGTTTGTCATG
CAGGAACTGAGCGAGAAACCGTGGCAGAAGGCCGTTCGCCAGAGCAGGCATCGCAGCTATGCGAAGGGTGCCGGCCGCCT
GTCTGCCGATATCGGCCGCAAGGTTGGCAATGTGATTGAGCCCGACGAATGCCCTGTCGACCTCTTTCCAGAGGGTCGTC
GCCTCCTGTGTGGGAATTATGTGGTTTCCGCGCCTTTCGAACAAATGAAGCCCGGTTGCATGCTCGAAGTCCTTGATAAG
CCGGCTGACGGCTGGCTGGGTCACCAACATCAGCTCTGCTGCCGCTGTCATCTGCCCAGTCAACATGACGGCCCGAAATG
CCTCAACCTGCCTTAGGTTCATAGCCTCACCATAGCATCTGCTTATTCTCGCCTATCCATTATGAATTTGACCTAATGCG
GGTCGAATGTAAACCTGAACTCATAAATGACAACTCTTCCGGACCAACCGGGGTCAGACGTGCGGCTAATCGGTCGCGCG
CAGGGAACGATATGGATTATTTTCAACTCATGGGCTTCGGCCCTGACGGCTGGGGCTATGAAATGCTCAAAGCGACCGGG
AGGACGGTCGCCGTGGCATTCAGCGGCTTCGCAATCGGCCTTGTCTTCGGCTGCCTTGGTGCCGCCGCAAGCTTTTCAAG
CTCGCGCGCTCTTCAGGCAACGGCATCCGCTTACACGACAGCGCTTCGTGGCATTCCGGACCTGCTTATCATCTATCTGT
TTTACTTCGGATCGAGCTCCGTCATTTCCGGTGTTGCCTCACTTTTCGGAAGTAGCGGTTTCGTTGGAGCTCCGTCGTTT
CTGATCGGCGCGCTTGCCATCGGCGTTGTTTCCGGAGCTTATCAAACCCAGGTACTGCGCGGCGCGGTTCTGGCGCTCCA
CAAGGGAGAAGTCGAGGCAGGTCGAGCGTACGGCATGGGTTCTTTCCTGTTGTTCCGCCGGATCGTTCTTCCGCAGGCGG
CTCGGTATGCATTGCCGGGTGTTGGCAATGTCTGGCAGCTGGTTCTTAAGGAATCCGCACTGATCTCGGTGATCGGCCTT
GTCGAACTGATGCGCCAGGCGCAGGTCGGTTCGGGGTCGACGCGCCAGCCGTTCAGCTTCTATCTCACTGCTGCAGCACT
CTACCTGTCTATTACTTTTGTCTCCGGACAGGCTTTCCGCCTGGCTGAGGCGCGCTCAATGCGCGGATTGCGGAGGGGCG
TGTGATGCCGTTCGATCCCGCATTCCTCTGGCAGACCTTCGTTGCTTTGCTGGCCGGTATTCCGCTCGCGCTCAAGCTCG
CGGTTTTTTCGGTTGCGGCAGGTACGGTCCTTGCTTTCGGATTGGCTCTGATGCGTGTGTCGCGCCGCTGGTGGCTTGAT
CTGCCAGCGCGGTTCTACATTTTCGCGTTTCGCGGCACGCCGCTCCTCGTCCAGATCTACATCATCTACTATGGCCTCAG
CCAGTTTCCGGAGCTTCGGCATAGTTTCATCTGGCCATTCCTGCGCGATGCCTATTGGTGCGCGATGACGGCGCTTGCAT
TGAATACGGCTGCTTACAGTGCCGAAATCATGCGAGGCGGACTGCTCTCCGTGCCCGCAGGTCAAATTGAAGCCGCCAAA
GCCTGCGGTATGGGCAGGGTAAAACTGTTCCGGCGGATCGTCATCCCGCAGGCGATACGCCAGATGCTGCCAGGCTACAG
CAATGAAGTGATCCTGATGGTCAAGTCGACGTCTCTCGCGTCCACCATCACCATCATGGAAATCACCGGAATTGCCGCGA
AACTGATCTCGGAAAGCTATCGCACCGTCGAGGTTTTTGCCTGTGCCGGCGCAATCTACCTCATCCTCAACTTCATCGTT
GCGCGTCTCTTCACGTTGCTCGAATGGGCTTTGTGGCCCGAGCGACGCAAAGGGAGACGCACGTCCGATCCCGTCGATCG
AAAAGGCGAAATCCATGCCTAACCCTGCTCGCCCAGCTGTTCAGCTGACAGACATCAGGAAAAACTTCGGTAACCTGGAG
GTCCTCCACGGTGTATCGCTGACGGCCAACGAGGGAGAAGTGATCTCGATCCTCGGCTCGTCGGGCTCTGGCAAGTCGAC
GCTTCTGCGATGCGTCAATATGCTCGAAGTCCCGAATGCCGGAAGCGTTGCGATCATGGGCGAAGAGATTGCCCTGGAGC
ATCGAGCCGGCCGGCCCGCTCGTCCAAAGGATATCAAGCAGGTCAACAGGCTCCGGGAGCGGGCCGCAATGGTCTTCCAG
GGCTTCAATCTCTGGTCACACCTGACGATACTCCAGAATGTTATGGAAGCGCCCTTGCATGTTCAGGGCCGTGACCGGAA
GTCGTGCCGCGATGAGGCTGAGGCATTGCTTGAGCGCGTTGGTATTGGCTCCAAGCGCGATGCCTACCCATCCGAGCTGT
CCGGCGGCCAGCAGCAACGTGCAGCAATTGCCCGTGCCCTGGCGATGCGACCGGATGTCATGCTGTTTGATGAGCCCACG
TCGGCTCTTGATCCGGACCTCGTCGGTGAAGTTCTAAAGGTTATGCGTGATCTGGCGGCCGAGGGCCGAACCATGCTGAT
CGTCACTCACGAAATGGATTTTGCCCGCGATGTTTCATCGCGCACAGTCTTCTTGCACCAAGGTGTCATCGCCGAAGAAG
GCCTTTCGTCCGAAATGTTCGCCCACCCCCGCACGGATCGCTTCCGGCAATTCCTGCGGCGCGACGGCGGTACATCCCAC
TGACGATCAATTCGTCACGGCTCGCGTGTCCAGGAAACAAATGAACAGAGGTGAACTTATGAAACTCAAAACTATTCTGT
GCGCAGCGCTTCTCCTTGTTGCCGGTCAGGCAGCAGCCCAGGAAAAGTCGATTACAATCGCGACCGAGGGCGGGTATGCG
CCCTGGAACTTTTCGGGACCAGGCGGCAAGCTCGACGGCTTCGAGATCGATCTCGCCAACGCCCTGTGCGAGAAGATGAA
GGCGAAATGCCAGATCGTCGCGCAGAACTGGGATGGCATTATCCCGTCGCTGACCGGCAAAAAGTACGATGCGATCATGG
CCGCCATGAGCATCACCCCAAAACGGCAGGAAGTGATCGGCTTCTCGACTCCGTACGCAGCAGGCATCAACGGTTTTGCC
GTCATGGGTGACAGCAAGCTGGCGGACATGCCAGGCACGGGCGAAACCTATTCGCTCGACAGCCAGGCAGATGCCGCCAA
AAAGGCTATTGCCGACATATCGAGCTTCCTGAACGGCACCTCGGTCGGCGTGCAGGGATCGACCACAGCATCGACTTTCC
TGGACAAGTATTTCAAGGGTGCCGTGGATATCAAGGAATACAAGTCCGTCGAGGAGCACAACTTCGACCTGACGAGCGGT
CGACTGGATGCTGTTTTGGCAAACGCAACCGTACTCGCCGCGGCAATTGAAAAGCCGGAAATGAAGGGCGCGAAGCTCGT
CGGGCCGCTTTTCTCCGGTGGCGAGTTCGGCGTGGTCGCTGTTGGCCTTCGCAAGGAAGACACCGCACTCACGGCTGATT
TTGACGCAGCCATCAAGGCGGCAAGCGAAGACGGCACCATCAAGACGCTCTCGTTGAAGTGGTTCAAGGTGGACGTCACC
CCCCATTGATCGGTCGCTTCCAGGGGATACGGCGTTCGCGCCGTATCCCGGTGCTGCGAATAAACAAGACCGCCGAGATA
CGATGTACGAAGTTGATATGAGCATTATCGGAGGCGGCCTGGTCGGCGCCTCGATTGCCTGGGGTCTAGCACGCTCAGGA
ACGAAGCCTCTCGTCCTCGACGGCGCGGATCTGGATCTGCGTGCATCGCGCGCCAATTTCGCGCTGGTCTGGGTGCAGGG
TAAAGGGCTGCATGCGCCCCATTACGCTCTTTGGTCAGATGCGTCCGCCAAGAGATGGCCGACGATGGCAAAAGCCCTGT
TCGACGACAGCGGCATCGACGTCGGTCTTCAACAGGACGGAGCATATACCTTCGCACTCTCTGAAGAGGAACTCGAGGTC
AATCGCGAGGATATGGAAAGCATTGCGCTCGAAACAAACGGGCGAGCTCCGCAATTTGAGGTATTGAATCGCCAGCAGAC
GCTTGACCGCGTGCCGGGTATCGGCGCGGAGGTTGTAGGCTCGATCTATTGTGCTGCGGACGGACACGTGAATGCACTTC
GCCTCTTCCACGCGCTTCACGCAGCGATGGAAAAGAAAGGGGTGACCTATCGTCCAAACCATCATGTTCAAACCATCGAA
CCAAAGACTGAAGGCTTCATTCTCAAGGGTGATGGGTTTTCCATATTTTCACGCCGGGTCGTTCTCGCCGCCGGCCTCGA
AAACGAGAGGCTGGCGCCAATGGTCGGGCTGTCTTGCCCGCTCAAGCGTAGCAAGGGCCAGATCCTCGTCACGGAAAAGA
GCCAGACCGCCCTGCCGTGCCTCTCTGCCGGAATGCGGCAGGCCGACGAAGGTGGTATCATGATCGGCGATAGCGAAGAG
ACCGACAGCGCCAAAATCTCATCGTGATCCGAAATCAGCGCCGTGCTGGCCAGCCGGGCCTTAAGAATTTTCCCCGCCCT
TTCTGATCTGAACGTCCTGCGCAGCTGGACGGGTTTCAGGGTCAAAACGGCGGATGGAATACCCATTTACGATCATTCCG
AGCGCCACCCGGGTGCATTCCTCGTCGCCTGCCATTCTGGCGTAACCTTGGCTGCCAATCACGCACTCATCGTGGCACCG
CAGATTGCCGCGGGTAAGCTTGACGACGATCTGTCAGCCTTTTCCGCCCGGAGGTTCCATGCTCATCAGGCTGCATAGGA
TAGAGCAACCCGTCCAGTTCACCTTCGATGGCGTGATCATCCAGGCTGAGCGGGGAGATATGCTCGCCACCGCTGTGCTT
GCCGCGGGGATCGACCACGTTCGGCAATCCGTCGTTAGCAAGAGCCCGCGCGCGCCCTACTGCCTGATGGGCGTTTGCTT
CGAGTGTTTGGTCACCGTGGATGGCGTGCAGAATCGTCAAGCTTGTCTGACCGAGGTCGAAGACGGGATGACGGTTATGA
GCCAGATGGGCGCGCCCACATTCCCGAAGCTCGCGACAAGCGAAGAGGGGATAGTCCCATGAGCCTTCGCGAAGTCTCAA
CAGCATCGGACCTTCTGGCTTTTTACGACCTTCTCGTCATCGGCGCGGGACCTGCAGGTATGGCGGCCGCTGTCGAAGCG
TCTGCGGCTGGTGCCCGCGTTACGGTACTGGACGAAAACCCCCGTCCGGGCGGACAGATCTACCGCGAGATCACACGAAA
CAGTCCCGACAAAAGAATCTTTCTCGGTCCCGACTATTGGAAGGGAAAGCCGCTCGCAGAAGCGTTCGGTCTCAGCAACG
TCGATTATGCGCCACGCGCCACGGTCTGGAGCCTGGAAAACCGGGACGAAACGGCGGATCAGACACGCAATGTCGTCGGC
GTGACCGTGGCCGGCTCGGCCCGAATGATTGAAGCTGAGGCTGTTGTTCTTGCCACCGGCGCACAGGAGCGTCCCATGCC
GGTGCCCGGCTGGACCTTGCCAGGCGTGATGACCGCGGGCGCTGCTCAGATCGCCCTCAAGGCAGCCGGAGCGATGCCAT
CGGGACCTGTGGTCATGGCTGGTTGCGGACCACTTCTCTATCTGCTGGCAAGTCAGCTCGTCGATGCAGGCGTATCTGAT
CTCACCGTGCTCGATACTGCTCAATCTCCCTTCCGGCTCGGCGTGCTCCGACACATGCCCGAATTCATGCTTTCACCTTA
CGTGTTGAAAGGCATAGGCTTGCTGGCGAAGGTAAAACGTCATGCACGCGTGGTTTCCGGCGTCAGATCCATTGCGATCA
CCGGCATCGAGCGCGCTGAAGGCGTGCGTTTCACCACAACCGGTAACGAACAAGTCCTCCCTGCCAGCTCGGTGCTCTTG
CACCAGGGGGTGATTCCGTCGACGAGCCTGACCAATGCAGCGGGCTGTGAGTTGAAATGGAATGACGAACAGCGTGCGTT
CGAGCCTGTCGCAGATCATGAAGGTCGGACCACCAAGGCAGGCATTTATGTCGCCGGCGACGGAGCCGGGATCGCAGGTG
CTCAAGCCGCGGAGGTCAGCGGACGCATCGTTGCACTTGCGGCACTTTCTGACTTGGGGCTTGGCAGTACGACGGCAGTG
CCTACGCCGATCAAATCTCTGCACAAGAAAGCCCGCCGCTTCCTGCGCGGAAGGGCGTTTCTGGATGCTCTCTACACACC
CCGTTCGGGCTTCCTCGCACCGGCAAACCCCGAAACAATCGTCTGCCGCTGTGAAGAAATCACAGTGCGCAAGCTGCGGG
AGGCCATTGCGCTTGGACCGCCCGGTCCGAACCAGTTGAAAACATTTGTTCGCTGCGGAATGGGCCAATGCCAGGGCCGT
CTTTGTGCAGCGACCGTCACAGAAATCATGGCGGAAGAAAGAAAGATCAGCCCCGGCGAAGTGGGAACCTATCGCCTTCG
TTCGCCAGTCAAGCCCGTTCGGCTTGCTGAACTTGCACATCTCCCGCACACGCCCCACGCGCTGAAGGCGGTAACCGGCA
GGGATCCTGTCGATCATGACACCAACGAAGCAGGACATTTCTCATGACAGAGCGACTTATCCGGATGCCGACATTGCATC
GCGTCGTCAAGCATAACGGCATCGCCTACATCGGCGGGATCGTCGCTGACGATGAAAGCCTCGGCATGGAAGGGCAGACC
CGTCAGGTCCTGACCAAGCTCGATGCATATCTCAAAGAGGCAGGCTCAGAACGCGCAAACCTGCTCTCCGCCACGATCTT
TATCACCGACATGAACGTGAAGTCGCAAATGGATGCGGTCTGGAAGGAATGGTTCGCGCCGGCGGAGTTGCCCGCCCGCG
CGACCATCGGCGTCGCTGATCTCGGCGACACGACGCTCATCGAGCTAATCGCCACCGCTCACTACTGAACCTGGCGAAGC
CTTGGAGGCGGCTGCAAGATCGCAGTCGTTGCTGGAGATTGTTATGGAATGCATATTGATCGGAGCACCGCTGCAAATTG
GGGCAGGACATCTCGGTTGCGAGATGGGTCCGAGCGCGTTCAGGATCGCCGGTCTTGCCGGCGCGCTTGAAGAATTGGGG
CACAGGGTTCGGGACCTCGGCAATCTGGGTTCGAAGTCTGTTCCGGCAATCGCCCATGCCAACGCTTCCGTCCATCACCT
CGGTGAAACGGTGGCATGGATCAAGCTGCTTTCGGCGGCAGCTTACGAACACAGCAATAACAGTGTGCCGATCTTTCTTG
GCGGCGATCACACGATCTCCGCAGGAACGATCCCGGGAATTGCACGGCGCGCCTCGGAGAACGGTCGCCAACTCTTTGTT
CTCTGGCTTGACGCCCACACCGATTTCCATACGCTGGAAACCACCGTCAGCGGAAACCTGCATGGCACGCCCGTGGCCTA
CTATACTGGCCGGCGTGGATTCGAGGGCTTCTTTCCAGCGCTGAACCACGCCGTCCCGCCCGAAAACTTATGCATGATCG
GCATCAGGAGCGTTGATCCCGCAGAGCGGGACGCGTTGCGGTCCTCGTCGATAACCGTGCATGACATGCGTGCCATCGAT
GAACACGGGGTCGCCAGCGTGACCCGAACGTTCCTCGAGCGCGTCCGCGCCGCGAACGGGATGTTGCATGTCAGCTTCGA
CGTCGACTTTCTCGATCCGGAAATTGCACCCGCCGTTGGAACGACTGTCCCCGGCGGCGCGACGTTCCGCGAAGCGCACC
TGATCATGGAAATGCTTCACGACAGCGGTCTCGTCACCAGCCTGGATCTCGTCGAATTGAACCCCTTTCTCGATGAGCGC
GGGAAGACCGCACGGCTCATCGTAGATATCGTTGCAAGTCTCATGGGCAAGCGGGTCATGGATAGACCAACCCGCGCTGC
CTGAAATCTACCGTCGAATGACTGGAGGAATAATGACCGTCGATCGCAAGCTAAACGTGGTTCCGTTCGTAAGCGTGGAT
CACATGATGAAACTGGTGCTCAAGGTGGGTATTGATACCTTTCTCACTGAACTGGCAGCGGCGATCGAGGAAGACTTTCG
CCGTTGGCCCATTTTTGACAAGACGCCCAGGGTTGGCTCCCACTCCAGCGAGGGCGTCATCGAGCTGATGCCAACCAGCG
ATGGTGCACTCTACGGCTTCAAATACGTCAACGGCCATCCGAAAAACACGCGGGACGGCCGCCAGACGGTCACCGCTTTC
GGTGTCCTTGCCGATGTCGGAAACGGCTATCCGCTGCTTTTTTCGGAGATGACGATACTGACCGCGCTTCGCACTGCTGC
GACATCCGCTCTTGCCGCGAAATATCTGGCGCGACCGAACTCACGAACGATGGCCATCATCGGCAACGGCGCCCAGAGTG
AGTTCCAGGCTCGCGCCTTCAGAGCGCTCCTCGGAATCCAGGAACTGCGTCTCTACGACATTGATCCAGCTGCGACGCGG
AAATGCACACGCAATCTTACCGGACTTGGCTTCAACATCGTTGAATGCAAATCGGTCGCCGACGCCGTTGAGGGCGCAGA
CATCATCACCACTGTCACCGCCGACAAACAGTACGCAACAATCGTGTCTGACAATCATGTCGGACCAGGTGTTCATATCA
ACGCTGTAGGCGGCGATTGCCCCGGCAAGACGGAGATCAGCAAAGAGGTCCTGCTGCGCTCGGACATCTTCATAGAGTAT
CCACCGCAGACCTGGATCGAAGGCGACATTCAGCAGCTTCCTGCGTCGCATCCGGTTACTGAGCTTTGGCAGGTTATGAC
CGGCGACGCGATCGGCCGAAGCAATGATAAGCAGATCACCTTGTTCGATAGTGTCGGCTTCGCAATCGAGGACTTCTCGG
CCTTGCGCTATGTCCGCGGCAAGATTGCCGAATTCGCCTTGTTTACCGAGCTGGATTTGCTGGCAGATCCAGACGAGCCT
CGTGACCTCTATGGCATGCTCCTGCGCTGTGAGAAGAAGCTCGAGCTGGCATAGG
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment