Skip to content

Instantly share code, notes, and snippets.

@iimog
Created Nov 24, 2014
Embed
What would you like to do?
Example fasta that causes a NullPointerException in RDPClassifier crossvalidate
>164458368 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Heracleum;s__Heracleum sphondylium
ACGCATTCACTTGCCCAAAACCACACACTCCTTGAGGAGCTGTGTTGGTTTGAGGGCGGAAATTGGCCTCCCATGCCTTCTCGCATGGTTGGCAAAAAAATGAGTCTCTGGCTATGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGGGCGAATCCGGGTCATCTTAACGAGCTCCAGGACCCTTAGGCGGCACACATTGTGTGCGCTTCGA
>298507601 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia richardsonis
ACGCCAAAAGACACTCCCCACCCAACCTAGTGGGGACGTGGTATTTGGCTCCTCGTGTCGTTATGCACGGTGGGCAAAAGTTGGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGGTGCTACGATACAAGCCGTGTACGGCGATGCTATGGCCCTTTGGACCCATTTAATCGAAGCGCGCGTCGCTCGAACCGCGA
>298507603 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia seatonii
ACGYCAAAAGACACTCCCCRCCTATCTGAGTAGGGATGTGGTATTTGGCCCCTCGTGCCTTTGCGTGCGGTGGGCAAAAGTTGGGGCTGCCGGCGGAGCCGATCACAGCACAAGGTGGATGACGTAAGTTGTTCTCGGTGCTACGATAYGAGCCGCACACGGCAATGCTATGGCCCTTTGGACCCATCAATCGAAGCGCGTGTCGCTCGAACCGCGA
>164458369 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Tordylium;s__Tordylium elegans
ACACATTGACTTGCCTACAACCACACACTCCTTGGAGATGTGCTGGTTTGTGGGCGGAAACTGGTCTCCCGTGCCTTCTTGCGTGGTTGGCAAAAAAGCGAGTCCCGGATACGGATGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGGGCAAATCCGTGTCATTGTAGGGAGCTCCAGGATCCTTAGGCGAAACACACTTTGTGCGCCTTGA
>298507604 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia setarioides
ACGCCAAAAGACACTCCCCACCCATCTTGGTGTGGATGTGGTATTTGGCCCCTCGTGCCTTTGTGCACGGTGGGCAAAAGATGGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGGAAGTTGTTCTCGGTGCTATGATATGAACCGCTTACGGCGATGCTATGGCCCTTTGGACCCATCCATCGAAGCGCATGTCGCTCGAACCGCGA
>164458366 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Heracleum;s__Heracleum franchetii
ACGCATTCACTTGCCCACAACCACACACTCCTTGAGGAGCTGCGTTGATTTGGGGGCGGAAATTGGCCTCCCATGCTTTCTCGCATGGTTGGCAAAAAAGTGAGTCTCTGACTATGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGGGCGAATCTGGGTCATCTTAACGAGCTCCAGGACCCTTAGGCGGCACACATTGTGTGCGCTTCGA
>164458360 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Heracleum;s__Heracleum millefolium
ACGCATTGACTTGCCCACAACCACACACACTCCTTGAGGAGCTGTGCCGGTTTGGGGGCGGAAACTGGCCTCCCGTGCTTTCTCGCGTGGTTGGCAAAAAAGTGAGTCTCCGGCTACGGACGTCGTGACATTGGTGGTTGTGAAAGACCCTCTTGTCTTGTCGGGCGAATCCGGGTCATCTTAGCGAGCTCGAGGACCCTTAGGCGGCACACATTGTGTGTGCTTTGA
>164458361 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Heracleum;s__Heracleum maximum
ACGCATTCACTTGCCCACAACCACACACTCCTTGAGGAACTGCGTTGGTTTGTGGGCGGAATTTGGCCTCCCATGCCTTCTCGCATGGTTGGCAAAAAAGTGAGTCTCTGGCTATGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGGGCGAATCCGGGTCATCTTAACGAGCTCCAGGACCCTTAGGCGGCACACATTGTGTGCGCTTCGA
>82658701 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Asterales;f__Asteraceae;g__Ligularia;s__Ligularia caloxantha
GGCGTCACACATCGCGTCGCTCCCACCACGCCTCCTCGATGGGGATGCTTGGATGTGGGCGGAGATTGGTCTCCCGTTCCCTATGGTGCGGTTGGCTAAAATAGGAGTCCCCTTCGACGGACGCACGATTAGTGGTGGTTGACAAGACCCTCTTATCAAGTTGTGCGTTCTAAGGATTAAGGAATATCTCTTCAATGACCCCAATGTGCCGTCCTGTGACGATGCTTCGACC
>82658700 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Asterales;f__Asteraceae;g__Ligularia;s__Ligularia nelumbifolia
GGCGTCACACATCGCGTCGCCCCCACCACGCCTCCTCGATGGGGATGCTTGGATGCGGGCGGAGATTGGTCTCCCGTTCCTATGGGGCGGTTGGCTAAAACAGGAGTCCTCTTCGACGGACGCACGATTAGTGGTGGTTGACAAGACCCTCTTATCAAATTGTGCGTTCTAAGGAGTAAGGAACATCTCTTCAATGACCCCAATGTGTCGTCTTGTGACGATGCTTCGACC
>77737555 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Asterales;f__Asteraceae;g__Layia;s__Layia glandulosa
ACGCATCATGTCGCCCCAACAATAATCCTTCATAGGATGCTTTGTATGTGGGCGGAGATTGGTCTCCCGTGTCAATGATGCGGTTGGCCTAAATATGAGTCCCATTGAGATGGACGCACSATTTGTGGTGGTTGATTAAACAGTCGTCTCGTGTTGTGTGKTTAGATTCTTGATGTGGAAGGCTCTTAAAACCCCCARATGTGTTGTCTTTTGATGGCGCTTCGA
>77737556 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Asterales;f__Asteraceae;g__Layia;s__Layia discoidea
ACGCATCATGTTGCCCCAACAATAATCCTTCATAGGATGCTTTGTATGTGGGCGGAGATTGGTCTCCCGTGTCAATGATGCGGTTGGCCTAAATATGAGTCCCATTGAGATGGACGCACGATTTGTGGTGGTTGATTAAACAGTCGTCTCGTGTTGTGTGTTTAGATTCTTGATGTGGAAGGCTCTTAAAACCCCTAGATGTGTTGTCTTTTGATGGCGCTTCGA
>566082102 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Solanales;f__Solanaceae;g__Athenaea;s__Athenaea micrantha
ACGCATCGCGTCGCCCCCCCGCTCCGCTCCCGCGAAAGGGCAGCGGCGGCGTCGGGGGGCGGATACTGGCCTCCCGTGCGCCTAGAGCCCGCGGCCGGCCTAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGGAACCCAACTCTCGTGGCGCCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCGGACCCTTACGGCGCTTAGGCGCTCCGACCGCGA
>566082103 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Solanales;f__Solanaceae;g__Aureliana;s__Aureliana sellowiana
ACGCATCGCGTCGCCCCCCCGCTCCGCTCCCCCGAAAGGGCAGCGGCGGCGTCGGGGGGCGGATACTGGCCTCCCGTGCGCCTAGAGCCCGCGGCCGGCCGAAATGCGAGTCCACGTCGACGGACGTCGCGGCAAGTGGTGGTTGGAACCCAACTCTCGTGGCGCCGCGGCCACAGCCCGTCGCGCGTGCGGACTCCCGGACCCTTCCGGCGCTTAGGCGCTCCGACCGCGA
>298507609 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia torreyi
ACGCCAAAAGACACTCCCCACCAATCTCGGTGCGGATGTGGTATTTGGCTCCTCGTGCCTTTGTGCGCGGTGGGCATAAGTTGGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGGTGCTACGATACGAACCGCTCACGGCAATTGTACGGCCTTTTGGACCCATTGACCGAAGCGCACGCCGCTCGGACCGCGA
>298507605 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia sinuosa
ACGCCAAAAGACACTCCCCACAAATCTTTGTGCGGATGTGGTATTTGGCTCCTCGTGCCTTTGGGCGCGGTGAGCAGAAGTTGGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGGTGCTATGGTACGGACTGCTGACGGCGAGCATGGCCCTTTGGACCCATTGACCGAAGCGCACGCCGCTCGGACCGCGA
>298507608 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia tenuifolia
ACGCCAAAAGACACTCCCCTCCCATCCTGGTGGGGACGTGGTATTTGGCCCCCCGTGCCTTTTGGCACGGTGGGCAAAAGTTGGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGATGCTAGGATACGGACAGCTTATGGCAATGATATGGCCCTTTGGACCCATTGATCGAAGTGCACGTCGCTCGGACCGCGA
>298507607 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia stricta
ACGCCAAAAGACACTCCCCACCAATCTCGGTGTGGACGTGGTATTTGGCCCCTCGTGCCTTAGCGTGCGGTGGGCAGAAGTTTGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGGTGCTACGATACGAACCGCTTACGGCAATGCTATGGCCCTTTGGACCCTTCGACCGAAGCGCATGCCGCTCGGACCGCGA
>164458359 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Tetrataenium;s__Tetrataenium sublineare
ACGCATTGACTTGCCCACAACCACACACTCATTGAGGAGCTGTTCCGGTTTGGGGATGGAAACTGGCCTCCCGTGCCTTCTCGCGTGGTTGGCAAAAAAGTGAGTCTCGGGCTACGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGGGCGTATCCGTGTCATCTTATCGAGCTCCAGGACCCTTAGGCGGCACACATTGTGTGCGCTTTGA
>298507614 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia wrightii
ACGCCAAAAGACACTCCCCACCCATCCTAGTGGGGACGTGGTATTTGGCCCCTCGTGCCTTTGGCGCGGTGGGCAAAAGTTGGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGGTGCTACGATACGAGCCGCATACGGCGATGCYATGGCCCTTTGGACCCATCAATCGAAGCGCGCGTCGCTCGAACCGCGA
>164458358 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Heracleum;s__Heracleum hookerianum
ACGCATTGACTTGCCCACAACCACACACTCCTTGAGGAACTGTGCCGGTTTGGTGGCGAAAATTGGCCTCCCGTGCCTACTCGCGTGGTTGGCAAAAAAGCGAGTCTCGGGCTATGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGGGCGTATCTGGGTCATCTTATCGAGCTCTAGGACCCTTAGGCGGCACACATTGTGTGCGCTTTGA
>298507615 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia plumiseta
ACGCCAAAAGACACTCCCCACCCATCTTGGTTGGGACGTGGTATTTGGCCCCTCGTGCCTTTCGGCGCGGTGGGCACAAGTTTGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGGCGCAAGTTGTTCTCGGTGCTGTGATATGAACCGCTTACGGTGATGCTATAGCCCTTTGGACCCATGGATCGAAGCGCACATCGCTCGGACCGCGA
>164458357 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Heracleum;s__Heracleum bhutanicum
ACGCATTGACTTGCCCACAACCACACACTCCTTGAGGAGCTGTGCCGGTTTGGTGGCGGAAATTGGCCTCCCGTGCCTTCTTGCGTGGTTGGCAAAAAAGTGAGTCTCGGGCTACGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTTTCTTGTCGGGCGTATTCGGGTCTTCTTATCGAGCTCCAGGACCTTTAGGCAGCACACATTGTGTGCGCTATGA
>298507612 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia villiflora
ACGCCAAAAGACACTCCCCACCCATCCTAGTGGGGACGTGGTATTTGGCCCCTCGTGTCTTTGGGCGCGGTGGGCAMAAGTTGGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGTTGCTACGATACGAGCCGCATACGGCAATGCTATGGCCCTTTGGACCCATCAATCGAAGCGCGCGTCGCTCGAACTGCGA
>164458356 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Tetrataenium;s__Tetrataenium nepalense
ACGCATTGACTTGCCCACAACCACACACTCTTTGAGGAGCTGTGCCGGTTTGGGGGCTGAAATTGGCCTCCCGTGCCTTCTCGCGTGGTTGGCAAAAAAGTGAGTCTCGGGCTACGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTTTTGTCTTGTCGGGCATATCCGGGTCATCTTATCGAGCTCCAGGACCCTTAGGCGGCACACATTGTGTGCGCTTTGA
>298507613 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia virescens
ACGCCAAAAGACACTCCCCACCATTATTAGTGGGGACGTGGTATTTGGTCCTTCGTGCCTTTGCGCGCGGTGGGCAAAAGTTGGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGGTGCTATGATACGAACCGCATACGGCAATGCTATGGCCCTTTGGACCCATCAATCGAAGCGCGCGTCGCTCGTACCGCGA
>164458355 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Heracleum;s__Heracleum sp. JHP-2008
ACACATTGACTTGCCCACAACCACACACTCCTTGAGGAGCTGTGCCGGTTTGGGGGCAAAAATTGGCCTCCCGTGCTTTTTGTGTGGTTGGCAAAAAAACGAGTCTCGGGCTACGGACGTTGTGACATTGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGGGCGTATTCGGGTCATCTTATCGAGCTCTAGGACCCTTAGGCAGACACATTGTGTGCGCTTTGA
>298507610 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia utilis
ACGCCAAAAGACACTCCCCACCCAATCTAGTGGGGACGTGGTATTTGGCCCCTCGTGCCGTTGCGCACGGTGGGCAAAAGTTGGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGGTGCTAAGATACGAGCCGTGTACGGCGATGCTATGGCCCTTTGGACCCATTAATCGAAGCGCGCGTCGCTCGAACCGCGA
>164458354 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Heracleum;s__Heracleum cachemiricum
ACACATTGATTTGCCCACAACCACACACTCCTTGAGGAGCTGTGCCGGTTTGGGGGCGGAAACTGGCCTCCTGTGCCTTCTCGCGTGGTTGGCAAAAAAGTGAGTCTTCGGCTACGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGGGCGGATCCGGGTCATCTTAGCGAGCTCCAGGACCCTTAGGCGGCACACATTGTGTGCGCTTC
>298507611 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia vaginata
ACGCCAAAAGACACTCTCCACCAATCCTGGTGCGGATGTGGTATTTGGCCCCTCGTGCGTTTGTGCACGGTGGGCAGAAGTTGGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGGTGCTACGATAGAAACCGCTTACGGCAATTGTACGGCCCTTTGGACCCATTGACGAAGCGCACGCCGCTCGGACCGCGA
>588283810 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Boraginales;f__Boraginaceae;g__Trichodesma;s__Trichodesma africanum
ACGCATCGCGTCACCCCTCCACACTTTCCGTGGATGGGGTGGAATGTGACCTCCTGTGCTTAAGGTGCAGCTGGTCAAAATTTGAGTCCAAAGACTAGGATGTCACGACAAGTGGTGGTTGGATAACAACTCGTGTCCTGTCGTGTGCCGAACCTCTTGTGACCATCGAGACCCAATTGCACTTGATATCCTCCTCCTCGGAGAGGTAGCGTGTGCTACGA
>164709908 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Cyperaceae;g__Carex;s__Carex spinirostris
GCCCATCCACGCTCGGCTGCCCAACCAGGGGCAGAGATGCGGAGACTGGCCCTCCGAACCGCGAGGCGCGGTGGGCCCAAGTGTGCGGCCGTCGTACGTGGCCGGGAGCGGCGAGTGGTGGGCTACTGCGCACGCCACCCCGAGCCCCGTGCCGACGCAGGGCCCTGTACGACCCCCTAACGAGGAGCAAGCCGGTGCGGCTGCGGCCGCGCGGCGCCTTCGGACCGATACC
>164709909 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Cyperaceae;g__Carex;s__Carex ternaria
TTAGAAGCCCATCCACGCTCTGTTGCCTAACCAACGGCAAAGATGCGGACATTGGCCCTCCGAGCCGCGAGGCGCGGTGGGCCTAAGTGTGCGGCCGTCGTATGTGGCCGGGAGCGGCGAGTGGTGGGCTACTGCGCACGTCACCCCGAGTCCCGTACTGACGCAGGGCCTTGTACGACCCCCCTAACGAGGAGCACGCTGCCGCGGCTTGCGCTGCGCGGCGCCTTCGGAC
>164458352 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Zosima;s__Zosima absinthifolia
ACGCATTGACTTGCCCACAACCACACACTCCTTGAGGAGCTGTGCCGGTTTGGGGGCGGAAACTGGCCTCCCGTGCTTTCTTGCGTGGTTGGCAAAAAAGCGAGTCTCCGGCTACGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGGGCGGATTCGGGCCATCTTAGGGAGCTCCAGGACCCTTAGGCGGCACACATTGTGTGCGCTTTGA
>164458351 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Semenovia;s__Semenovia transiliensis
ACGCATTGACTTGCCCACAACCACACACTCCTTGAGGAGTTGTGCTGGTTTGGGGGCGGAACCTGGCCTCCCGTGCCTTCTCGCGTGGTTGGCAAAAAAGCGAGTCTCCGGCTACGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTGTCTTGTTGGGCGGATCCGGGTCTAGCGAGCTCCAGGACCCTTAGGCGGCACACATTATGTGCGCTTTGA
>164458350 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Semenovia;s__Semenovia dasycarpa
ACGCATTGACTTGCCCACAACCACACACCCCTTGAGGAGCTGTGCCGGTTTGGGGCGGAAATTGGCCTCCCGTGCCTTCTTGCGTGGTTGGCAAAAAAGCGAGTCTCCGGCTACGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTATCTTGTCAGGCGGATCCGGGTCATCTTAGCGAGCTCCAGGACCCTTGGGTGGCACACATTGTGTGCACTTT
>77737539 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Asterales;f__Asteraceae;g__Layia;s__Layia glandulosa
ACGCATCATGTCGCCCCAACAATAATCCTTCATAGGATGCTTTGTATGTGGGCGGAGATTGGTCTCCCGTGTCAATGATGCGGTTGGCCTAAATATGAGTCCCATTGAGATGGACGCACGATTTGTGGTGGTTGATTAAACAGTCGTCTTGTGTTGTGTGTTTAGATTCTTGATGTGGAAGGCTCTTAAAACCCCCAGATGTGTTGTCTTTTGATGGCGCTT
>588283809 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Brachypodium;s__Brachypodium distachyon
ACGCCAAAACACGCTCCCACCCTTCCTCGTGGGGAGCAGGACGCGGCATATGGCTCCTCGTGCCCCTAGGCGCGGTGGGCCGAAGATCGGGCTGCCGGCATATCTATCGTGCCGGGCACAGCGCGTGGTGGGCGATCTCGCTTTACTCAGCGCAGCGCTGCAGGTGCGTAGCCGGCGTAATGGCCTCAGAGGGCCCCAAAGAACGGAGTGCGCGTCGCTCCGACC
>77737542 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Asterales;f__Asteraceae;g__Layia;s__Layia glandulosa
ACGCATCATGTCGCCCCAACAATAATCCTTCATAGGATGCTTTGTATGTGGGCGGAGATTGGTCTCCCGTGTCAATGATGCGGTTGGCCTAAATATGAGTCCCATTGAGATGGACGCACGATTTGTGGTGGTTGATTAAACAGTCGTCTCGTGTTGTGTGTTTAGATTCTTGATGTGGAAGGCTCTTAAAACCCCCAGATGTGTTGTCTTTTGATGGTGCTTCGA
>77737546 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Asterales;f__Asteraceae;g__Layia;s__Layia glandulosa
ACGCATCATGTCGCCCCAACAATAATCCTTCATAGGATGCTTTGTATGTGGGCGGAGATTGGTCTCCCGTGTCAATGATGCGGTTGGCCTAAATATGAGTCCCATTGAGATGGACGCACGATTTGTGGTGGTTGATTAAACAGTCGTCTCGTGTTGTGTGTTTAGATTCTTGATGTGGAAGGCTCTTAAAACCCCCASATGTGTTGTCTTTTGATGGTGCTTCGA
>588283801 Root;k__Viridiplantae;p__Streptophyta;c__rosids;o__Fabales;f__Fabaceae;g__Melilotus;s__Melilotus indicus
ACATATCGAAGCCTCTTGCCAATTTCCTTTTGATAGGTATTGTGCATGCTGGTGAATGTTGACCTCCCGTGAGCTCTATTGTCTCATGGTTGGTTGAAAATCGAGACCTTGGTAGGGTGTGCCATGATAGATGGTGGTTGTGTGACCCACGAGAACCTTGATCATGTGCTGCCCTATTCAAATATGGCCTCTTTTACCCATATGCGTTTTGAAAACGCTCGTGATGAGA
>164709906 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Cyperaceae;g__Carex;s__Carex pumila
GCCCATCCACGCTCGGCTGCCCGACTAGCGGCAGAGATGCGGACACTGGCCCTCCGAACCGCGAGGCGCGGTGGGCCTAAGTGTGCGGCCGCCGTACGTGGCCGGGAGCGGCGAGTGGTGGGCTGCTGCGCACGCCGCCCCGAGCCCCGTACCGACGCAGGGCCCTGTACGACCCCCTAACGAGGAGCAAGCCGCCGCGGCTCCGGCCGCGCGGCGCCTTCGGACCGATACC
>164709905 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Cyperaceae;g__Carex;s__Carex ophiolithica
GCCCATCCACGCTCGGCTGCCTGAACGGGGGCAGAGACGCGGAAACTGGCCCTCCGAACCGCGAGGCGCGGTGGGCCCAAGTGTGCGGCCGTCGTACGTGGCCGGGAGCGGCGAGTGGTGGGCTACTGCGCACGCCACCCCGAGCCCCGTGCCGACGCAGGGCCCTGTACGACCCCCTAACGAGGAGCAAGCCGGTGCGGCTGCGGCCGCGCGGCGCCTTCGGACCGATACC
>77737541 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Asterales;f__Asteraceae;g__Layia;s__Layia glandulosa
ACGCATCATGTCGCCCCAACAATAATCCTTCATAGGATGCTTTGTATGTGGGCGGAGATTGGTCTCCCGTGTCAATGATGCGGTTGGCCTAAATATGAGTCCCGTTGAGATGGACGCACGATTTGTGGTGGTTGATTAAACAGTCGTCTCGTGTTGTGTGTTTAGATTCTTGATGTGGAAGGCTCTTAAAACCCCCAGATGTGTTGTCTTTTGATGGCGCTTTGA
>588283805 Root;k__Viridiplantae;p__Streptophyta;c__rosids;o__Fabales;f__Fabaceae;g__Melilotus;s__Melilotus indicus
ACATATCGAAGCCTCTTGCCAATTTCCTTTTGTAAGGTATTGTGCATGCTGGTGAATGTTGACCTCCCGTGAGCTCTATTGTCTCATGGTTGGTTGAAAATCGAGACCTTGGTAGGGTGTGCCATGATAGATGGTGGGTTGTGTGACCCACGAGAACCTTGATCATGTGCTGCCCTATTCAAATATGGCCTCTTTTACCCATATGCGTTTTGAAAACGCTCGTGATGAGA
>164709902 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Cyperaceae;g__Carex;s__Carex fretalis
GCCCATCCACGCTCGGCTGCCTAACCAAGGGCAGAGAYGCGGAAACTGGCCCTCCGAACCGCGAGGCGCGGTGGGCCCAAGTGTGCGGCCGTCGTACGTGGCCGGGAGCGGCGAGTGGTGGGCTACTGCGCACGCCACCCCGAGCCCCGTGCCGACGCAGGGCCCTGTACGACCCCCTAACGAGGAGCAAGCCGGTGCGGCTGCGGCCGCGCGGCGCCTTCGGACCGATACC
>588283806 Root;k__Viridiplantae;p__Streptophyta;c__rosids;o__Brassicales;f__Brassicaceae;g__Matthiola;s__Matthiola longipetala
ACAAATCGTCGTCCCCCCACCCATTTTCTATGGATAAGGGACGGAAGCTGGTCTCCCGTGTGATACCGCACGCGGTTGGCCGAAATCTGAGTTGGAGACGTTTGGATCTTCTCGACATGCGGTGGTGAAATCATATTTCCTCTCATTGTGTCGGTTGATCCTGTCTTTGAGCTCTCGATGACCCGAAATTCTCAAC
>164709901 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Cyperaceae;g__Carex;s__Carex enysii
AAGCCCATCCACGCTCGGCTGCCTCACGGCAGAGATGCGGACATTGGCCCTCCGAACCGCGAGGTGCGGTGGGCCTAAGTGTGCGGCCGTCGTACGTGGCCGGGAGCGGCGAGTGGTGGGCTACTGCGCGCGTCACCCCGGGCCCCGTACCGACAGAGGGCCTTGTTTGACCCCTAACGAGGAGACGCCGCCGCGGCTCGCGCCGCGCGGCGCCTTCGGACCG
>164709900 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Cyperaceae;g__Carex;s__Carex echinata
AGAAGCCCATCCACGCTCGGTTGCCTAACGGCAAAGATGCGGACATTGGCCCTCCGAACCGCGAGGCACGGTGGGCCTAAGTGTGCGGCCGTCGTATGCGGCCGGGAGCGGCGAGTGGTGGGCTACTGCGCACGTCACCCCGAGCCCCGTACCGACGCAGGGCCTTTTTTGACCCCTAACGAGGAGCCTGCCGTTGCAGCCTGCGCTGCGCGGCGCCTTCGGACCGATA
>164458348 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Heracleum;s__Heracleum candicans
ACACATTGACCTGCCCACAACCACACACTCCTTGAGGAGCTGTGCCGGTTTGGGGGCGGGAACTGGCCTCCCGTGCCTTCTCGCGTGGTTGGCAAAAAAGCGAGTCTCCGGCTACGGACGTCGTGACATTGGTGGTTTTAAAAGACCCTCTTGTCTTGTCTGGCGGATCCGGGTCATCTTAGCGAGCTCCAGGACCCTTAGGCGGCACACACTGTGTGCGCTTTGA
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment