Skip to content

Instantly share code, notes, and snippets.

Avatar

Markus J. Ankenbrand iimog

  • Center for Computational and Theoretical Biology
  • Würzburg
  • Twitter @IIMOG
View GitHub Profile
@iimog
iimog / TBro_Individual_CLA
Last active Apr 15, 2016
Individual Contributor License Agreement for TBro (derived from jQuery Foundation ICLA v3.0 https://contribute.jquery.org/CLA/)
View TBro_Individual_CLA
###Individual Contributor License Agreement
Thank you for Your interest in TBro. This document clarifies the terms under which You, the person signing this agreement, may make Contributions — which may include without limitation, software, bug fixes, configuration changes, documentation, or any other materials — to any of the projects owned or managed by TBroTeam.
Please read this agreement carefully. If You have questions about these terms, please contact us via [GitHub](https://github.com/TBroTeam).
You accept and agree to the following terms and conditions for Your present and future Contributions submitted to TBro. Except for the license granted herein to Us, You reserve all right, title, and interest in and to Your Contributions.
**Licenses**
View keybase.md

Keybase proof

I hereby claim:

  • I am iimog on github.
  • I am iimog (https://keybase.io/iimog) on keybase.
  • I have a public key whose fingerprint is A09D B088 B121 3D2E 5594 A81D 1303 8317 284F 6FAC

To claim this, I am signing this object:

@iimog
iimog / minimal.tax
Created Nov 24, 2014
Example tax that causes a NullPointerException in RDPClassifier crossvalidate
View minimal.tax
0*Root*-1*0*rootrank
1*k__Viridiplantae*0*1*kingdom
2*p__Streptophyta*1*2*phylum
3*c__asterids*2*3*class
4*o__Apiales*3*4*order
5*f__Apiaceae*4*5*family
6*g__Heracleum*5*6*genus
7*s__Heracleum sphondylium*6*7*species
8*c__Liliopsida*2*3*class
9*o__Poales*8*4*order
@iimog
iimog / minimal.fa
Created Nov 24, 2014
Example fasta that causes a NullPointerException in RDPClassifier crossvalidate
View minimal.fa
>164458368 Root;k__Viridiplantae;p__Streptophyta;c__asterids;o__Apiales;f__Apiaceae;g__Heracleum;s__Heracleum sphondylium
ACGCATTCACTTGCCCAAAACCACACACTCCTTGAGGAGCTGTGTTGGTTTGAGGGCGGAAATTGGCCTCCCATGCCTTCTCGCATGGTTGGCAAAAAAATGAGTCTCTGGCTATGGACGTCGTGACATTGGTGGTTGTAAAAGACCCTCTTGTCTTGTCGGGCGAATCCGGGTCATCTTAACGAGCTCCAGGACCCTTAGGCGGCACACATTGTGTGCGCTTCGA
>298507601 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia richardsonis
ACGCCAAAAGACACTCCCCACCCAACCTAGTGGGGACGTGGTATTTGGCTCCTCGTGTCGTTATGCACGGTGGGCAAAAGTTGGGGCTGCCGGCGGTGCCGATCACAGCACAAGGTGGATGACGCAAGTTGTTCTCGGTGCTACGATACAAGCCGTGTACGGCGATGCTATGGCCCTTTGGACCCATTTAATCGAAGCGCGCGTCGCTCGAACCGCGA
>298507603 Root;k__Viridiplantae;p__Streptophyta;c__Liliopsida;o__Poales;f__Poaceae;g__Muhlenbergia;s__Muhlenbergia seatonii
ACGYCAAAAGACACTCCCCRCCTATCTGAGTAGGGATGTGGTATTTGGCCCCTCGTGCCTTTGCGTGCGGTGGGCAAAAGTTGGGGCTGCCGGCGGAGCCGATCACAGCACAAGGTGGATGACGTAAGTTGTTCTCGGTGCTACGATAYGAGCCGCACACGGCAATGCTATGGCCCTTTGGACCCATCAATCGAAGCGCGTG