Skip to content

Instantly share code, notes, and snippets.

Avatar

Jeremy Volkening jvolkening

  • BASE₂BIO LLC
  • Wisconsin, USA
View GitHub Profile
@jvolkening
jvolkening / lzw_fail.txt
Last active Jan 13, 2020
test strings that fails Compress::LZW validation
View lzw_fail.txt
TTTTTATTATTAACCATGAGAATTGTTGATAAATCTGTGGATAACTCTAAAAAAATTCCGGATTTATAAAAGTACATTAAAATATTTATATTTTAATGTAAATATTATATCACTTTTTCACAAAAACGTGTATTATATATAAGGAGTTTTGTAAATTATTTAACTATATTACTATGTAATATAGTTATTATATCAAAACAAACTAAAACAGTAGAGCAACCTTTAAAAATTAACTAAAAACTAAATACAAATTTGTTTATAGACGAAAGTTTTTCTATTAATATCCCCACATTAACTCTATAAAAACCCCTATACTAAAAAAAAACACACTCTGAATACATAACTTGTATGTAAAGTTTGAGTGAAGTTAAATCGCTTTAATATTGTAACAATATTGTTTGTAAAAATATTTATTTAATATGAAAAAAATATTGTGATTTTTATCGGAAATATTGTGATTTTCTAATTCAGGCCAATTAAAAATATCAAAACTAATTACTTAAATAAAAATATCAATAAATAAATTAAAAAACTTATTAACATTTCTACTAAGAGAGTTCGTATTTGGAAATAATATTAAAGTAATACACAATATTAAAAAAATATTTTTAGTATTTAAACGATTAAGTACTTTTTCATTCTTTTGTCTATCTGTAAAAGACACTAGGTAAGGATTACTTTATTAACAAGATAAAGAGAAAAGAATTTATTTTTAATAATACGATTTTAATATTTTTAAAATATTATTCAATTTACGTTGTTTTATTACCAAAAATAGAATATTAAAACAATATTTATAAGTTAATTAAAATTAATACTTTTTAAAACAAAACAACAATATTATTTCAATATGGTCACAGTAGTCACAATAAAGTTGATAATATTTAAATAATATTAATTAAATATTTATTCAAGAATTTATTATTCTTGAATAACAGCAAAAAACTTTTATAGAACTGAAGAGCATTCTTAAAAAAGAAAAAACCTAATGCTAACGGCATCAGAACTAACTAATACGAAAATA
@jvolkening
jvolkening / test.comet.pep.xml
Created Dec 14, 2018
test output from crux-comet
View test.comet.pep.xml
<?xml version="1.0" encoding="UTF-8"?>
<msms_pipeline_analysis date="2018-12-11T10:32:39" xmlns="http://regis-web.systemsbiology.net/pepXML" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xsi:schemaLocation="http://sashimi.sourceforge.net/schema_revision/pepXML/pepXML_v120.xsd" summary_xml="scrubbed">
<msms_run_summary base_name="scrubbed" msManufacturer="UNKNOWN" msModel="UNKNOWN" raw_data_type="raw" raw_data=".mzML">
<sample_enzyme name="Trypsin">
<specificity cut="KR" no_cut="P" sense="C"/>
</sample_enzyme>
<search_summary base_name="scrubbed" search_engine="Comet" search_engine_version="2018.01 rev. 0" precursor_mass_type="monoisotopic" fragment_mass_type="monoisotopic" search_id="1">
<search_database local_path="pp.fa" type="AA"/>
<enzymatic_search_constraint enzyme="Trypsin" max_num_internal_cleavages="1" min_number_termini="2"/>
<aminoacid_modification aminoacid="M" massdiff="15.994900" mass="147.035385" variable="Y" symbol="*"/>
View test_1000_new.fq
@M03709:10:000000000-AHW42:1:2106:18711:1744 1:N:0:AAGAGGCA+ACTGCATA
TATTCGTACTGAAAATCAAGATCAAGCGAGCTTTTGCCCTTCTGCTCCACGGGAGGTTTCTGGCCTCCCTGAGCTCGCCTTAGGACACCTGCGTTACGCTTTGACAGGTGTACCGCCCCAGTCAAACTCCCCACCTGACGCTGTCCCCGGAGCGGGGACAGCGTCAGGTGGGGAGTTTGACTGGGGCGGTACACCTGTCAAAGCG
+
>1>>>1B1>A3311DGG1111BB111B000EGHHHFGFGHHGHBAFFAAF////A?EFGFG21AAFGGGHC0BFGGAEEEE1111B0BFG0FCEGFFFEF/?12B11/BBFFFF/<<<<//@@121FGFGCBCCCG000/<<.<1<<G@?--@-----9..9-;A9?B;B.9---9;B//BF/A--A-----/99//99////BB
@M03709:10:000000000-AHW42:1:2106:16158:1799 1:N:0:AAGAGGCA+ACTGCATA
ACTTTAAATCCTTTAACGAGGATCCATTGGAGGGCAAGTCTGGTGCCAGCAGCCGCGGTAATTCCAGCTCCAATAGCGTATATTAAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGGAT
+
1>AAA331DD@FGGCGGE1110ACFBHHFFHHGGGGGFHHHHCG01A11/A0AGEG??E//FGDF2DGFFHGFGHHHGE?E1FE221BFFDFFHHHHHFFFD11/>FHEGCGGHB11<
@M03709:10:000000000-AHW42:1:2106:12433:1810 1:N:0:AAGAGGCA+ACTGCATA
GTTCAGACATTTGGTGTATGTGCTTGGCTGAGGAGCCACTGGAGCGAGGCTACCATCTGTGGGATTATGACTGAACGCCTCTAAGTCAGAATCCCCCCTAAAC
View test_100.fq
@M03709:10:000000000-AHW42:1:2106:18413:15530 1:N:0:AAGAGGCA+ACTGCATA
GCGCACCACCGGCCCGTCTCGCCCGCCTCGCCGGGGAGGTGGAGCATGAGCGCGCGTGCTAGGACCCGAAAGATGGTGAACTATGCCTGGGCAGGGCGAAGCCAGAGGAAACTCTGGTGGAGGTCCGTAGCGGTCCTGACGTGCAAATCGGTCGTCCGACCCGGGTATAGGGGCGAAAGACTAATCGAACCATCTAGTAGCTGGTTCCCTCCGAAGTTTCCCCAGGATAGCTGGCGCTCGGGGCGGCGGTG
+
AABCCCCFCCCCGGGGGGGGGGGGGGGGGGGGCGGGGFFEHGHHHEGHHHHGGGGGGGGGHHHHHHGG@FGGHGHHGHHHHHHHHHHGHHGHGGGGGGGGGGHHGGFGEHHHHHHHGGHDHHGGHHGHGGGGGADGGFGGGCAFGGEFGGFFFFFFFFFFFFFFA.@FFFFFDFFFCFFFFFFFFFFFFFFFFFFFFBFBFFFFFFFFFFFFFDFF9FFFFFFF?EFFFEFFBFFFFFFFFAAAFFCFB--
@M03709:10:000000000-AHW42:1:2106:11146:15531 1:N:0:AAGAGGCA+ACTGCATA
CCTCAGGATAGCTGGCGCTCGGGGCGGCGGTGCAGTTTTACCCGGTAAAGCGAATGATTAGAGGTCTTGGGGCCGAAACGATCTCAACCTATTCTCAAACTTTCAATGGGTAAGACGCCCGGCTCGCTGGCGTGGAGCCGGGCCGTGGAATGCGAGCGCTCAGTGGGCCACTTTTGGTAAGCAGAACTGGCGCTGCGGGATGAACCGAACGCCGGGTTAAGGCGCCCGATGCCGACGCTCATCAGAGCCCA
+
AAAABFFF4DFBGFBAE2AEE??EGGGGGGGEEEHEGBGHHF?E>>EFFFGGGCEHFFHH3GGFB0GFDFCC<BCGCGCGFHEHHHG0GHHFHHDBDDFFFHHGGHHGFF<0GDFHD@DCC-@@
View test_1000.fq
@SALLY:297:D1JLYACXX:7:1101:9691:17720 1:N:0:
AATTTTAGTCATGACAATAAATATAATACAGGAATAGTAGCTGATATGTTTTTAGTATTTACCATTTAAAATTTCCTTGCAATGTATTGTTATTCATGTCT
+
CCCFFFFFHHHHHJJJJJJJJJJJJJIJJJJJJJJIIHIIIJJGJJJJJJIJJHIGIIIJJIIJJJJJJJJJJJJHIJJJJJJJIHHHHHHHFFFFFFFED
@SALLY:297:D1JLYACXX:7:1101:9506:17722 1:N:0:
AATAATAATTACCTGTATTAGTACATTATTTAATTGTACCAAATCTCTTATATATAGTTAGTTCAGATATTTGGGGGGCTTTCCAGGTAGCTCAGTCGTAA
+
CCCFFFFFHHHHHJJHIJJJJHIJJJJJJJJGHIJIHIJJJJJJJJJJJJJIJJIJJJJJJIJJIJJIJIJJJJJHIDDDDDDDEDDCDDDDDDDDDDDDD
@SALLY:297:D1JLYACXX:7:1101:9656:17723 1:N:0:
CTACAGTTTATTTTTATTCATTTAATTTTTTTTTTTAACTTACATTTTGGAGAAGGAAATGGCAACCCACTCCAGGACTCTCTCCTGGAAAATACCATGGA
View gist:94d2bad18b906ed09c6dc8859ca88b27
Percolator version 3.01, Build Date Nov 16 2016 14:58:22
Copyright (c) 2006-9 University of Washington. All rights reserved.
Written by Lukas Käll (lukall@u.washington.edu) in the
Department of Genome Sciences at the University of Washington.
Issued command:
percolator -Y -t 0.02 -m test.sep.psm.tsv -r test.sep.pep.tsv test.sep.pin
Started Wed Mar 8 08:47:56 2017
Hyperparameters: selectionFdr=0.01, Cpos=0, Cneg=0, maxNiter=10
Reading tab-delimited input from datafile test.sep.pin
Features:
View gist:9d09edfedb997dc8be3d1dc87fb0d709
Percolator version 3.01, Build Date Nov 16 2016 14:58:22
Copyright (c) 2006-9 University of Washington. All rights reserved.
Written by Lukas Käll (lukall@u.washington.edu) in the
Department of Genome Sciences at the University of Washington.
Issued command:
percolator -t 0.02 -m test.concat.psm.tsv -r test.concat.pep.tsv test.concat.pin
Started Wed Mar 8 08:48:30 2017
Hyperparameters: selectionFdr=0.01, Cpos=0, Cneg=0, maxNiter=10
Reading tab-delimited input from datafile test.concat.pin
Features:
View mzml_reindex.pl
#!/usr/bin/env perl
# re-calculates index offsets and SHA1 sum for indexed mzML file that has been
# modified for some reason
use strict;
use warnings;
use XML::Parser;
use Digest::SHA;