Created
October 16, 2011 22:16
-
-
Save kellyrob99/1291497 to your computer and use it in GitHub Desktop.
BioGroovy reading fasta file
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
@GrabResolver(name='biojava', root='http://www.biojava.org/download/maven/') | |
@Grab('org.biojava:biojava3-core:3.0.2') | |
import org.biojava3.core.sequence.* | |
import org.biojava3.core.sequence.io.* | |
import org.biojava3.core.sequence.compound.* | |
def testFasta = '''> seq1 This is the description of my first sequence. | |
AGTACGTAGTAGCTGCTGCTACGTGCGCTAGCTAGTACGTCA | |
CGACGTAGATGCTAGCTGACTCGATGC | |
> seq2 This is a description of my second sequence. | |
CGATCGATCGTACGTCGACTGATCGTAGCTACGTCGTACGTAG | |
CATCGTCAGTTACTGCATGCTCG''' | |
File file = new File("${System.properties['java.io.tmpdir']}/tempFasta.fasta"); | |
file.text = testFasta | |
fastaProxyReader = new FastaReader(file, new GenericFastaHeaderParser(), new FileProxyProteinSequenceCreator(file, AminoAcidCompoundSet.getAminoAcidCompoundSet())); | |
fastaProxyReader.process().each{ | |
println it.key | |
println it.value | |
} |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment