Skip to content

Instantly share code, notes, and snippets.

Embed
What would you like to do?
$ bionode-ncbi search assembly phylos | jq .uid
"874841"
$ bionode-ncbi download assembly 874841
$ cd 874841/
$ gunzip GCA_001865755.1_ASM186575v1_genomic.fna.gz
$ head GCA_001865755.1_ASM186575v1_genomic.fna
>MNPR01000001.1 Cannabis sativa cultivar Cannatonic Cannabis.v1_scf1_q, whole genome shotgun sequence
GTGACAAGAGTAACCCTAACACCAGAGAAGGTGAATCTAGACCTGTTACGTGAAAAACTCAAAAGAATACATTCCCAGAA
ACTTCAAataccaaacccagaaaaacaaacagataAGTAAAGCATGCCATAAACACGAACAGTAAAGCAAGGGATGCGAG
AAACTTACAGTGAAGTGTTGAAACTGGGGGTTCTGTTGTCGATCAAACAAAGGAAATATAGGCTGACAGTGGTGAATGAA
GGATAACAGGGAAATTTGTAGAGTGTTCGAAGGTTTTTTCTTGGTCTGGGGATTTTGCTCTGAAAAACTCGAacaaagtt
ggcaagaaatggaaagtaaccaaatgaaggaaagatggtggcttttataggccaaagtgcatgaggaacaggcaccatca
cctaccaatcgaacggctGGGGgggcgcacgattcgaattcccaagaATCAACAGTTGGATTGATTCgtaattaaggcgg
tggaaacgcttgagtatccgtctgacaccattaatgcaccgtatcaatcaatggacatgaaacgaatcgacatctgcaaa
aagtgaatcgctgcattagAGGCGATCATTAAATGCACCTTCACGCGCTCAAAGCTCGTGCCAGGAAACTGAGGGGTCAA
TCGGAggcacttgaacaagccttgttttctttttcaaataaacaaggcttggggggtaaatgctgcccctgattttgccc
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment