This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
XCOPY "C:\PATH_TO_PROGRAM_OUTPUT_FOLDER\PROGRAM_NAME.clz" "C:\PATH_TO_SIMPL_PROGRAM" /Y |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
{ | |
"FlexVersionReferences": [ | |
{ | |
"Model": "Bean", | |
"Mode": "Teams", | |
"BIOS": "BECFL357.86A.0085.2020.1007.1917", | |
"WindowsOS": "10.0.19044 (21H2)", | |
"MTR": "4.15.54.0", | |
"ZoomRoom": "", | |
"ZRC": "", |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import json | |
print("Welcome to the CSI forensic tool!") | |
while True: | |
answer = input("You want to analyze DNA, import DNA or add suspects? (analyze/import/add): ") | |
if answer == "analyze": | |
#ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCCCCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGCCTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGGAAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCCCTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAGTTTAATTACAGACCTGAA |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# HW 2 |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
mood = "sad" | |
if mood == "happy": | |
print("It's great to see you happy!") | |
elif mood == "nervous": | |
print("Take a deep breath and count to 10") | |
else: | |
print("Cheer up, mate!") |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import random | |
import json | |
import datetime | |
def play_game(): | |
secret = random.randint(1, 30) | |
guess = 0 | |
attempts = 0 | |
wrong_guesses = [] |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import random | |
import json | |
import datetime | |
secret = random.randint(1, 30) | |
guess = 0 | |
attempts = 0 | |
with open("score_list.txt", "r") as score_file: | |
score_text = score_file.read() |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
mood = "nervous" | |
if mood == "happy": | |
print("It's great to see you happy!") | |
elif mood == "nervous": | |
print("take a deep breath") | |
else: | |
print("Cheer up") |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
from Player import Player | |
class BasketballPlayer(Player): | |
def __init__(self, first_name, last_name, height_cm, | |
weight_kg, points, rebounds, assists): | |
super().__init__(first_name, last_name, height_cm, weight_kg) | |
self.points = points | |
self.rebounds = rebounds |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
while True: | |
selection = input("Would you like to A) play a new game, B) see the best scores, or C) quit?") | |
if selection == "A": | |
play_game() | |
elif selection == "B": | |
for score in top_scores(): | |
print(score) | |
else: | |
break |
NewerOlder