Last active
February 24, 2021 06:47
-
-
Save krish8484/139bb62f593d693c8120e8b288bce4b0 to your computer and use it in GitHub Desktop.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
openapi: 3.0.0 | |
info: | |
title: Binding Scanner API Specification | |
license: | |
name: Apache 2.0 | |
description: >- | |
BindingScanner is a tool for predicting binding sites of distinct regulators | |
in an RNA sequence by calculating posterior probabilities with MotEvo, given | |
the sequence specificity of regulators, represented as position-specific | |
weight matrices. It is intended to help in the analysis of individual | |
reporter sequences, by predicting regulatory that may act on the sequence as | |
well as how the binding may be affected by specific mutations introduced in | |
the reporter sequences. The tools scans the input sequence with a set of | |
position-specific weight matrices (PWMs) representing the binding | |
specificity of individual RNA-binding proteins. | |
version: 1.0.0 | |
paths: | |
/runs/{id}/status: | |
get: | |
summary: 'Returns status of the run' | |
operationId: statusGet | |
description: This endpoint returns status corresponding to the id in path. | |
parameters: | |
- name: id | |
in: path | |
required: true | |
description: A unique identifier of the pipeline information. | |
example: 1234 | |
schema: | |
type: string | |
responses: | |
'200': | |
description: 'Status of the run' | |
content: | |
application/json: | |
schema: | |
type: string | |
'404': | |
description: 'Status unavailable for the run.' | |
content: | |
application/json: | |
schema: | |
$ref: '#/components/schemas/Error' | |
text/plain: | |
schema: | |
$ref: '#/components/schemas/Error' | |
/runs/{id}/table: | |
get: | |
summary: 'Returns merged tsv file' | |
operationId: TsvGet | |
description: This endpoint returns merged tsv file corresponding to the id in path. | |
parameters: | |
- name: id | |
in: path | |
required: true | |
description: A unique identifier of the pipeline information. | |
example: 1234 | |
schema: | |
type: string | |
responses: | |
'200': | |
description: 'Merged tsv file.' | |
content: | |
text/tsv: | |
schema: | |
type: string | |
'404': | |
description: File cannot be found. | |
content: | |
application/json: | |
schema: | |
$ref: '#/components/schemas/Error' | |
text/plain: | |
schema: | |
$ref: '#/components/schemas/Error' | |
/runs/{id}/heatmap: | |
get: | |
summary: 'Returns a pdf file with heatmap of binding sites' | |
operationId: HeatmapGet | |
description: This endpoint returns a heatmap pdf file corresponding to the id in path. | |
parameters: | |
- name: id | |
in: path | |
required: true | |
description: A unique identifier of the pipeline information. | |
example: 1234 | |
schema: | |
type: string | |
responses: | |
'200': | |
description: 'Heatmap pdf file.' | |
content: | |
application/pdf: | |
schema: | |
type: string | |
format: binary | |
'404': | |
description: File cannot be found. | |
content: | |
application/json: | |
schema: | |
$ref: '#/components/schemas/Error' | |
text/plain: | |
schema: | |
$ref: '#/components/schemas/Error' | |
/runs: | |
post: | |
summary: Register pipeline info. | |
description: Inputs for the binding scanner to process. | |
operationId: infoPost | |
requestBody: | |
description: Pipeline info to add. | |
required: true | |
content: | |
applcation/json: | |
schema: | |
type: object | |
properties: | |
sequence: | |
type: string | |
example: ATGTGAGTGAAGTGTGGGAAAGATGACTCGATATATCTGGATGCTAGGGATCGGATGGCGATACG | |
pwm_directory: | |
type: string | |
example: ATtRACT_hsa | |
background_binding_prior: | |
type: number | |
example: 0.99 | |
default: 0.99 | |
min_binding_posterior: | |
type: number | |
example: 0.01 | |
default: 0.01 | |
markov_chain_order: | |
type: number | |
example: 1 | |
default: 1 | |
responses: | |
'201': | |
description: Pipeline information was successfully uploaded. | |
content: | |
application/json: | |
schema: | |
description: Pipeline information identifier. | |
type: string | |
example: 1234 | |
'400': | |
description: The request is malformed. | |
content: | |
application/json: | |
schema: | |
$ref: '#/components/schemas/Error' | |
'500': | |
description: An unexpected error occurred. | |
content: | |
application/json: | |
schema: | |
$ref: '#/components/schemas/Error' | |
components: | |
schemas: | |
Error: | |
type: object | |
required: | |
- code | |
properties: | |
code: | |
type: integer | |
format: int32 | |
default: 500 | |
message: | |
type: string | |
default: Internal Server Error | |
servers: | |
# Added by API Auto Mocking Plugin | |
- description: SwaggerHub API Auto Mocking | |
url: https://virtserver.swaggerhub.com/krish8484/Binding-Scanner/1.0.0 |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment