Dima "Dagge" Kunin kundzi
kundzi
/ .deps...npm...@chainlink...contracts...src...v0.6...interfaces...AggregatorV3Interface.sol
Created
November 23, 2021 22:07
Created using remix-ide: Realtime Ethereum Contract Compiler and Runtime. Load this file by pasting this gists URL or ID at https://remix.ethereum.org/#version=soljson-v0.6.7+commit.b8d736ae.js&optimize=false&runs=200&gist=
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| // SPDX-License-Identifier: MIT | |
| pragma solidity ^0.6.0; | |
| interface AggregatorV3Interface { | |
| function decimals() | |
| external | |
| view | |
| returns ( | |
| uint8 |
kundzi
/ lists.json
Created
April 2, 2020 22:44
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| [ | |
| { | |
| "name": "General Todos", | |
| "urlName": "general", | |
| "todos": [ | |
| { | |
| "task": "Learn React", | |
| "isCompleted": true | |
| }, | |
| { |
kundzi
/ sana_labs_content_registry_api.json
Created
September 5, 2019 15:56
Postman collection of request covering https://sanalabs.com/developer/sana-learn/api#content-registry-endpoints
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| { | |
| "info": { | |
| "_postman_id": "78a06991-03ee-4e6d-a10c-30ca05298a6f", | |
| "name": "sana_learn_content_registry", | |
| "schema": "https://schema.getpostman.com/json/collection/v2.1.0/collection.json" | |
| }, | |
| "item": [ | |
| { | |
| "name": "Create / Update an Asset", | |
| "event": [ |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| template <typename K> | |
| unsigned long hash(K const & key) { | |
| // TODO | |
| unsigned long l = 0; | |
| for ( int i = 0 ; i < key.length; i++ ) | |
| l += ( stoi(k.at[i]) * ( i+1) ); | |
| return l; | |
| } // cat // tac -> collision! |
kundzi
/ split_dna.py
Last active
November 5, 2017 22:36
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| dna = """ACAAGATGCCATTGTCCCCCGGCCTCCTGCTGCTGCTGCTCTCCGGGGCCACGGCCACCGCTGCCCTGCC | |
| CCTGGAGGGTGGCCCCACCGGCCGAGACAGCGAGCATATGCAGGAAGCGGCAGGAATAAGGAAAAGCAGC | |
| CTCCTGACTTTCCTCGCTTGGTGGTTTGAGTGGACCTCCCAGGCCAGTGCCGGGCCCCTCATAGGAGAGG | |
| AAGCTCGGGAGGTGGCCAGGCGGCAGGAAGGCGCACCCCCCCAGCAATCCGCGCGCCGGGACAGAATGCC | |
| CTGCAGGAACTTCTTCTGGAAGACCTTCTCCTCCTGCAAATAAAACCTCACCCATGAATGCTCACGCAAG | |
| TTTAATTACAGACCTGAAG""".replace("\n", "").replace("\t", "").replace("\r", "").replace(" ", "") | |
| #1 using regular expression | |
| import re | |
| print re.split("TAG|TAA|TGA", dna) |
kundzi
/ formated.java
Created
September 30, 2017 07:50
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| package by.htp.servlet; | |
| import java.io.IOException; | |
| import javax.servlet.ServletException; | |
| import javax.servlet.http.HttpServlet; | |
| import javax.servlet.http.HttpServletRequest; | |
| import javax.servlet.http.HttpServletResponse; | |
| public class FirstServlet extends HttpServlet { |
kundzi
/ Vasily_Zalunin.cpp
Last active
October 27, 2016 11:05
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| // bac cab cba | |
| bool isAnagram(string str1, string str2) { | |
| if (str1.empty() && str2.empty()) return true; | |
| if (str1.size() != str2.size()) return false; | |
| sort(str1.begin(), str1.end()); | |
| sort(str2.begin(), str2.end()); | |
| return str1 == str2; | |
| } | |
| EXPECT_EQ(isAnagram("",""), true) |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| // Here is the test lives | |
| package com.company; | |
| import com.google.common.base.Preconditions; | |
| import com.google.common.collect.Lists; | |
| import java.util.ArrayList; | |
| import java.util.function.Consumer; | |
| public class Main { |
kundzi
/ list_comp_qsort.py
Created
February 12, 2015 07:34
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| def qsort(xs): | |
| if len(xs) < 2: return xs | |
| lq = qsort([x for x in xs[1:] if x <= xs[0]]) | |
| gt = qsort([x for x in xs[1:] if x > xs[0]]) | |
| return lq + xs[0:1] + gt |
kundzi
/ newyear.go
Created
December 25, 2014 17:10
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| package main | |
| import ( | |
| "math/rand" | |
| "fmt" | |
| "time" | |
| ) | |
| type Pack struct { | |
| name string |
NewerOlder