-
-
Save lzamparo/5635881af4c01f056de21bbfd2f2aea5 to your computer and use it in GitHub Desktop.
test fasta file
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>chr15:98503514-98503614 | |
TGGCTCCTGCAAAGTCCTTACGCTGCTAGAAACCCCGCCCCCGTTCGTAACTATGGGAACGGCTGACACGCTGAGAGCCG | |
GAGATAACCCTGTTCCGCCC | |
input interval: chr15:98503524-98503528 | |
expected output: TGCA |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment