Fastool ?bug

#Using Fastool downloaded with the most recent version of Trinity.

  fastool --rev  --illumina-trinity --to-fasta pero_left.2.fastq >> left.fa
  Sequences parsed: 164311463

#I have a number of reads that are not appended with the /1 that is supposed to happen with --illumina-trinity

  grep HSQ-7001360:67:H88RHADXX:1:1101:10000:20192 left.fa
  >HSQ-7001360:67:H88RHADXX:1:1101:10000:20192
  
#This read seems to be properly formatted in the input file:

  grep HSQ-7001360:67:H88RHADXX:1:1101:10000:20192 pero_left.2.fastq
  @HSQ-7001360:67:H88RHADXX:1:1101:10000:20192 1:N:0:CCGTCC
  
#Most other reads are properly anotated with the /1 by fastool

  head left.fa
  >HSQ-7001360:67:H88RHADXX:1:1101:1448:2158/1
  GGATATCTGACAATGTGACGTTTCTACATTTTTATATAAAGCAGATTTTTAAAATACAAGTGAGATAACATTTTCCTCTTGAAAATGATTATCTTACAAAAAAATAAACCTTGTATAAATTAAGCC
  >HSQ-7001360:67:H88RHADXX:1:1101:1444:2179/1
  ACGAGCCTACTTTACATCCGCCACTATAATTATCGCCATTCCAACAGGAGTAAAAGTATTCAGTTGATTAGCCACACTTCACGGAGGAAATATTAAATGATCACCAGCAATACTATGATCCCTAGG
  >HSQ-7001360:67:H88RHADXX:1:1101:1526:2104/1
  TATCATGTCTTCACTAGCAACAGGAAAATACACATGGTGTTTACTAAAATTGTTTACTACATTCAAATTCCCTTTTATTTTTTTAGTAGCCCAAGCTCTTGAGTTTTTCAAGACATTGTTTTCTGA
  >HSQ-7001360:67:H88RHADXX:1:1101:1648:2136/1
  TAAATGTTTTAGGCAGTCTAAGAACAAATGTAAAAGTAAAGACGCAGTAAAATGAATTGCTTGGTGTTCACTGCTCCATGTGTATCAAGCACAGCGGGAAACAAAACCCCC
  
#Not sure what the issue is here.

Hi @macmanes,
could you send me a small FastQ with the sequences that are not appended ? Thanks