Last active
January 9, 2016 06:12
-
-
Save meren/29e56db37d1cf385c98f to your computer and use it in GitHub Desktop.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
grep -B 1 GCCGTAAACGGTGGGCGCTAGGTGTGAGGGTCTTTTCACGACTTTCGTGCCGTAGCTAACGCATT peerj-7636-Long-Read.fasta --color | grep -v '^--$' > test.fa | |
muscle -in test.fa > test-aligned.fa | |
facount test-aligned.fa | |
446 | |
fasta2oneline test-aligned.fa -o test-oneline.fa | |
o-smart-trim test-oneline.fa --from-start -o test-good-starts.fa | |
o-smart-trim test-good-starts.fa --from-end -o test-good-ends.fa | |
o-trim-uninformative-columns-from-alignment test-good-ends.fa | |
mv test-good-ends.fa-TRIMMED test-final.fa | |
facount test-final.fa | |
403 | |
entropy-analysis test-final.fa --quick # gives me this: https://imgur.com/yWsYXjg | |
fastaunique test-final.fa -o test-final-unique.fa | |
facount test-final-unique.fa | |
94 | |
grep '>' test-final-unique.fa | awk 'BEGIN{FS="|"}{print $2}' | head -n 10 | |
frequency:190 | |
frequency:70 | |
frequency:12 | |
frequency:11 | |
frequency:9 | |
frequency:7 | |
frequency:4 | |
frequency:4 | |
frequency:3 | |
frequency:3 | |
entropy-analysis test-final-unique.fa --quick # gives me this: http://i.imgur.com/dBDGdx5.png |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment