This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
""" | |
Partial Correlation in Python (clone of Matlab's partialcorr) | |
This uses the linear regression approach to compute the partial | |
correlation (might be slow for a huge number of variables). The | |
algorithm is detailed here: | |
http://en.wikipedia.org/wiki/Partial_correlation#Using_linear_regression | |
Taking X and Y two variables of interest and Z the matrix with all the variable minus {X, Y}, |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
--- src/cxx/lib/io/Xml.cpp 2018-01-05 14:12:25.000000000 -0500 | |
+++ src/cxx/lib/io/Xml.cpp 2018-01-05 14:12:35.000000000 -0500 | |
@@ -168,19 +168,11 @@ | |
if (!tree.empty()) | |
{ | |
unindex(*tree.begin(), treeWithIndexAttributes); | |
-#ifndef WIN32 | |
- boost::property_tree::write_xml(os, treeWithIndexAttributes, boost::property_tree::xml_writer_make_settings(' ', 2)); | |
-#else | |
boost::property_tree::write_xml(os, treeWithIndexAttributes, boost::property_tree::xml_writer_make_settings<std::string>(' ', 2)); |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>Illumina Single End Apapter 1 | |
ACACTCTTTCCCTACACGACGCTGTTCCATCT | |
>Illumina Single End Apapter 2 | |
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT | |
>Illumina Single End PCR Primer 1 | |
AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT | |
>Illumina Single End PCR Primer 2 | |
CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT | |
>Illumina Single End Sequencing Primer | |
ACACTCTTTCCCTACACGACGCTCTTCCGATCT |