This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/usr/bin/env python | |
| """Galaxy Tool Shed diff command.""" | |
| import sys | |
| import os | |
| import subprocess | |
| import tempfile | |
| from optparse import OptionParser | |
| VERSION = "v0.0.1" |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| # Walks specified folders looking for .shed.yml files, | |
| # with at least owner and name given. | |
| # | |
| # Matches the owner/name with the remote Tool Shed, and | |
| # takes any missing meta-data from the remote Tool Shed. | |
| # | |
| # Pre-existing local data otherwise should be preserved. | |
| # | |
| # Does the yaml dump with some hackery because I couldn't | |
| # work out how to make the library use the layout I wanted. |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| from Bio import SeqIO | |
| with open("CP008802.txt", "w") as output: | |
| output.write("Seqname\tSource\tfeature\tStart\tEnd\tScore\tStrand\tFrame\tAttributes\n") | |
| for record in SeqIO.parse("CP008802.gbk", "genbank"): | |
| print("Converting %s" % record.name) | |
| for f in record.features: | |
| if f.type != "gene": | |
| continue | |
| locus_tag = f.qualifiers["locus_tag"][0] | |
| if len(f.location.parts) > 1: |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #Copyright 2011 Peter Cock, released under GPL v3 licence | |
| # | |
| #Hack script to extract files in selected directories in one git | |
| #repository and apply them to another repository using a potentially | |
| #different directory structure. | |
| # | |
| #This written in Python and needs the git library, I used 0.3.2 RC1 | |
| #https://github.com/gitpython-developers/GitPython | |
| # | |
| #I assume when run both repositories are clean (no untracked files, |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| from Bio import SeqIO | |
| import sys | |
| ids = set(x[:-1] for x in open(sys.argv[1])) | |
| wanted = (rec for rec in SeqIO.parse(sys.stdin, "fastq") if rec.id in ids) | |
| SeqIO.write(wanted, sys.stdout, "fastq") |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| from Bio.SeqIO.QualityIO import FastqGeneralIterator | |
| import sys | |
| ids = set(x[:-1] for x in open(sys.argv[1])) | |
| for title, seq, quals in FastqGeneralIterator(sys.stdin): | |
| if title.split(None,1)[0] in ids: | |
| print "@%s\n%s\n+\n%s\n" % (title, seq, quals) |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| import zlib | |
| import time | |
| def decompress(comp_data): | |
| d = zlib.decompressobj(-15) #Negative window size means no headers | |
| uncomp_data = d.decompress(comp_data) + d.flush() | |
| del d | |
| return uncomp_data, zlib.crc32(uncomp_data) | |
| def compress(orig_data): |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| >ref | |
| AGCATGTTAGATAA**GATAGCTGTGCTAGTAGGCAGTCAGCGCCAT |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| # | |
| # A hack, loosly based on Eric Rasche's disgusting.py | |
| # https://gist.github.com/erasche/4ac3448b036f09979e14 | |
| # | |
| # Intended as a one-off use script to help with syncing local | |
| # .shed.yml files with a Galaxy Tool Shed. See also: | |
| # https://gist.github.com/peterjc/5ebbf446d799f3aaa639 | |
| import yaml | |
| import os |
This file contains hidden or bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| #!/usr/bin/env python | |
| #Example usage: | |
| # | |
| # $ python ace_to_contig_stats.py < example.ace > example_stats.tsv | |
| # | |
| import sys | |
| from Bio.Sequencing import Ace | |
| sys.stdout.write("#Contig\tPadded length\tUnpadded length\tReads\n") | |
| for contig in Ace.parse(sys.stdin): |
OlderNewer