- A book about modern masculinity The Will To Change
- I love Kurzgesagt, they make great science education posters and books
- David Mitchell (comedian not the famous author) wrote a history book, I would like the audiobook! Unruly
- Terry Pratchett short stories A Stroke of the Pen
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
AQAAAAMAAAAAAAAAAgACAAMAogCbAJMAAwCiAJsAkwABAAUAAQAFAAAAWQAAAIJu1XMCAIJu1XMCAIJuGnQCAKhuXnQCAM5u53QCABtvtHUCAI5vxnYCAE1wYHgCADNxP3oCAItyMH0CAFZ07oACACJ2rIQCAIZ4e4kCAN55bIwCADd7044CAGl8spACACh9xJECAMF91pICADR+o5MCAIF+cJQCAPR++ZQCAEB/gpUCAGZ/xpUCAI1/T5YCALN/T5YCANl/lJYCAP9/2JYCACaAHJcCAEyAHJcCAHKAHJcCAJmAYZcCAL+AYZcCAOWApZcCAAuB6pcCADKBc5gCAFiBQJkCAH6ByZkCAMuBDZoCAPGBlpoCAD6C2poCAGSCH5sCAIqCH5sCANeCH5sCAP2CH5sCAEmDH5sCALyDH5sCAAmE2poCAHyElpoCAMiEUZoCADuFDZoCAK6FyZkCAEeGhJkCALqGhJkCAFOHQJkCABKI+5gCAF+I+5gCAKuIt5gCANGIt5gCANGIc5gCANGILpgCAKuILpgCAIWILpgCADiI6pcCAOyH6pcCAMaH6pcCAHmHpZcCAFOHpZcCAAaHYZcCAOCGYZcCALqGYZcCAJOGHJcCAG2GHJcCACGGHJcCANSF2JYCAGGF2JYCABWF2JYCAKKE2JYCAFWElJYCAAmElJYCAOODlJYCAOOD2JYCAOODHJcCAAmEHJcCAAmEYZcCAAmEpZcCAAmE6pcCAAmELpgCAOODLpgBAOODLpgEAAMAsACEAEAAAwCwAIQAQAAAADQAAADBYH9yAgDBYH9yAgDnYH9yAgANYX9yAgANYTtyAgA0YTtyAgBaYfZxAgCAYfZxAgDNYbJxAgDzYW1xAgBAYilxAgBmYilxAgCMYuVwAgCyYuVwAgD/YqBwAgAlY1xwAgBLYxdwAgCYYxdwAgC+Y9NvAgDlY49vAgALZEpvAgAxZEpvAgBXZAZvAgB+ZMFuAgDKZH1uAgDwZDhuAgAXZThuAgA9ZfRt |
The goal in this example is to count the number of books each author has written, from a list of book objects.
Example input:
const books = [
{ author: "Jane", name: "Foo: a bar" },
{ author: "John", name: "Tale of Zim" },
{ author: "Jan", name: "Legend of Gir" },
{ author: "Jane", name: "Zig 2: the sequel" },
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
{ | |
"/slf4j-logkit/org/slf4j/implStaticLoggerBinder.java": { | |
"coveredLines": 7, | |
"totalLines": 78 | |
}, | |
"/slf4j-logkit/org/apache/jmeter/loggingLogkitLoggerAdapter.java": { | |
"coveredLines": 137, | |
"totalLines": 327 | |
}, | |
"/slf4j-logkit/org/apache/jmeter/loggingLogkitLoggerFactory.java": { |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
var assert = require('assert'); | |
describe('Synchronous timeout', () => { | |
beforeEach(() => { | |
var x = Date.now(); | |
while (Date.now() < x + 2100) {} | |
}); | |
it('Tests nothing', () => assert.equal(1, 1)); | |
}); |
Prototype for a Perch-inspired CMS template.
- Tags based on handlebars, using JS syntax for arguments
- Four tags:
block
- defines a named section in the CMSrepeat
- allows items to repeated; can set min, max or exact number of repetitionscontent
- defines a piece of content, same kind of configuration as Perch, sensible defaults based on where the tag is used (i.e. text in a<p>
, URL in ahref
, text in analt
),template
- loads another file as a template, templates can contain any of the four tags
Thinking about something like: {{ template('shared/content', {shared: true}) }}
to allow templates to be shared across different pages.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env bash | |
set -euo pipefail | |
for BRANCH in $(git branch | grep -E -v "^(\* | (develop|master|main)$)"); do | |
if [[ -z $(git --no-pager log develop..$BRANCH --author=$(git config user.email)) ]]; then | |
git branch -D $BRANCH | |
fi | |
done |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
sudo find / -name ".DS_Store" -depth -exec rm {} \; |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
html .cmsms_color_scheme_fourth h1, | |
html .cmsms_color_scheme_fourth h2, | |
html .cmsms_color_scheme_fourth h3, | |
html .cmsms_color_scheme_fourth h4, | |
html .cmsms_color_scheme_fourth h5, | |
html .cmsms_color_scheme_fourth h6, | |
html .cmsms_color_scheme_fourth h1 a, | |
html .cmsms_color_scheme_fourth h2 a, | |
html .cmsms_color_scheme_fourth h3 a, | |
html .cmsms_color_scheme_fourth h4 a, |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
from __future__ import division | |
print '\nExample 1' | |
# Input DNA 1 | |
dna = "ACTGATCGATTACGTATAGTATTTGCTATCATACATATATATCGATGCGTTCAT" | |
print 'DNA:', dna | |
# Calculate AT count | |
A_count = dna.count("A") |
NewerOlder