Skip to content

Instantly share code, notes, and snippets.

pvanheus

Block or report user

Report or block pvanheus

Hide content and notifications from this user.

Learn more about blocking users

Contact Support about this user’s behavior.

Learn more about reporting abuse

Report abuse
View GitHub Profile
View toil-log.txt
$ toil-cwl-runner --preserve-environment PATH --singularity ./example.cwl ./example-job.cwl
/usr/people/pvh/miniconda3/envs/toil/lib/python2.7/site-packages/cwltool/__init__.py:17: CWLToolDeprecationWarning:
DEPRECATION: Python 2.7 will reach the end of its life on January 1st, 2020.
Please upgrade your Python as the Python 2.7 version of cwltool won't be
maintained after that date.
""", category=CWLToolDeprecationWarning)
INFO:cwltool:Resolved './example.cwl' to 'file:///usr/people/pvh/toil/example.cwl'
WARNING:toil.batchSystems.singleMachine:Limiting maxCores to CPU count of system (24).
WARNING:toil.batchSystems.singleMachine:Limiting maxMemory to physically available memory (33714651136).
View test-annotated.vcf
##fileformat=VCFv4.2
##FILTER=<ID=PASS,Description="All filters passed">
##fileDate=20191113
##source=freeBayes v1.3.1-dirty
##reference=reference/ref.fa
##contig=<ID=Chromosome,length=4411532>
##phasing=none
##commandline="freebayes -p 2 -P 0 -C 10 --min-repeat-entropy 1.5 --strict-vcf -q 13 -m 60 --min-coverage 10 -F 0.05 -f reference/ref.fa snps.bam --region Chromosome:0-4411532"
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus">
##INFO=<ID=RO,Number=1,Type=Integer,Description="Count of full observations of the reference haplotype.">
View test.vcf
##fileformat=VCFv4.2
##FILTER=<ID=PASS,Description="All filters passed">
##fileDate=20191113
##source=freeBayes v1.3.1-dirty
##reference=reference/ref.fa
##contig=<ID=Chromosome,length=4411532>
##phasing=none
##commandline="freebayes -p 2 -P 0 -C 10 --min-repeat-entropy 1.5 --strict-vcf -q 13 -m 60 --min-coverage 10 -F 0.05 -f reference/ref.fa snps.bam --region Chromosome:0-4411532"
##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus">
##INFO=<ID=RO,Number=1,Type=Integer,Description="Count of full observations of the reference haplotype.">
View gist:23e97c823007d12e41726403eb50937d
DEBUG conda.gateways.logging:set_verbosity(231): verbosity set to 2
DEBUG conda.core.solve:solve_final_state(222): solving prefix /home/pvh/anaconda3/envs/rgi
specs_to_remove: frozenset()
specs_to_add: frozenset({MatchSpec("rgi")})
prune: <auxlib._Null object at 0x7f64fad13ac8>
Collecting package metadata (current_repodata.json): ...working... DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True
View gist:aa1fa6b47073a034ec36083d2ad81515
DEBUG conda.gateways.logging:set_verbosity(231): verbosity set to 2
DEBUG conda.core.solve:solve_final_state(222): solving prefix /home/pvh/anaconda3/envs/rgi
specs_to_remove: frozenset()
specs_to_add: frozenset({MatchSpec("rgi=5.1.0")})
prune: <auxlib._Null object at 0x7f2630af0a20>
Collecting package metadata (current_repodata.json): ...working... DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True
DEBUG conda.core.package_cache_data:_check_writable(259): package cache directory '/home/pvh/anaconda3/pkgs' writable: True
View consensus_tree.nhx
(MTB_anc:0.0000404279,(ERR552627:0.0000095331,((ERR552650:0.0000037342,((((((((((((((ERR552714:0.0000016579,(ERR552408:0.0000008225,ERR552184:0.0000007560)93:0.000000231)90:0.000000696,(((ERR553080:0.0000045365,((ERR552633:0.0000026571,(ERR552243:0.0000018134,ERR553326:0.0000013601)100:0.000001425)95:0.000000683,ERR551209:0.0000031228)98:0.000000753)96:0.000001007,ERR552360:0.0000014937)84:0.000000755,ERR552967:0.0000011968)97:0.000001811)80:0.000000301,ERR552867:0.0000028514)85:0.000000749,ERR552368:0.0000020435)92:0.000000933,(((((((ERR551425:0.0000015400,(((ERR553305:0.0000015318,((ERR550804:0.0000020422,ERR552380:0.0000002294)86:0.000000694,ERR551517:0.0000015567)69:0.000000289)87:0.000000458,ERR551049:0.0000013181)91:0.000000926,ERR553279:0.0000002522)80:0.000000440)75:0.000000492,(((((ERR553288:0.0000011334,ERR551021:0.0000009067)98:0.000000774,((((((((((ERR552854:0.0000005301,ERR550691:0.0000019543)98:0.000000680,ERR552629:0.0000017437)100:0.000001673,(ERR553115:0.0000011389,(ERR551913:0.0000004540,E
View snp_msa.fasta
>MTB_anc foo
CCCCGGGAGCCCGGTAGGCCGTCGGATGCGTCCCGCCCGGCGCGCCGTCCGCCACTCGGT
CGCACGCCCGGCCGGCCCCTAATGTTCGGCCACACCGAGCGGGCGAGAGGGGTGACTCGG
AGTCCCGGAGGCCGCCCCGGCCGAGTGCGTCGCCCACGCCGCGGCTTCCATGTGACATGC
TGGCCGAGCAGACAGAAGACGGGACGATCGCCCTCACGCGCGGGGGACCCGTGTGCAGGT
CCGGGGCCCGCAAGGCGACATGCCAACGGGCTTACACCCAATCTCCGCTGCTGTCCGCCA
ACACACGGTATTCCCCGGCGCGCCAGCCACGGGCTCTGGAGAACACCCATGACGGGGCGC
CCCGGCGCCCCCCCACGGAGAGGTACCGCCGCGGGAGCTCAGGGGGGCAGTTCTGGCCCT
ACGGAGGGCGGCTGTAGCCCGCCCTCTGCCCGAGCGGAGTCTCGGGGGCGGCGGGGACCT
CCGGATGCGTCTCTGAGGAGGTCTCGCGCCGCGTAGTTTGGTCTCAGCGCGACTGCGCCC
View kraken2.cwl
#!/usr/bin/env cwl-runner
cwlVersion: v1.0
class: CommandLineTool
id: kraken2
baseCommand:
- kraken2
inputs:
database:
type:
- Directory
View manipulating_data.R
library(tidyverse)
surveys <- read_csv("data_raw/portal_data_joined.csv")
str(surveys)
select(surveys, plot_id, species_id, weight)
select(surveys, -record_id, -species_id)
filter(surveys, year == 1995)
surveys2 <- filter(surveys, weight < 5)
View starting_with_data.R
download.file(url = "https://ndownloader.figshare.com/files/2292169",
destfile = "data_raw/portal_data_joined.csv")
getwd() # show where I am
surveys <- read.csv("data_raw/portal_data_joined.csv")
head(surveys)
View(surveys)
weight_g <- c(10, 50, 30)
You can’t perform that action at this time.