Skip to content

Instantly share code, notes, and snippets.

View galaxy.json
{"failed": true, "dataset_id": 68, "type": "dataset", "ext": "data", "stderr": "Failed to find file_path %s.bkp in {u'%s.idx': {u'name': u'hard_masked_seabass_genome.seq', u'file_type': u'spalndbnp', u'space_to_tab': False, u'uuid': None, u'dbkey': u'?', u'auto_decompress': True, u'path': u'/home/pvh/Documents/code/Masters/galaxy/database/tmp/upload_file_data_xU_6zT', u'purge_source': True, u'type': u'file', u'to_posix_lines': True}, u'%s.seq': {u'name': u'hard_masked_seabass_genome.bkn', u'file_type': u'spalndbnp', u'space_to_tab': False, u'uuid': None, u'dbkey': u'?', u'auto_decompress': True, u'path': u'/home/pvh/Documents/code/Masters/galaxy/database/tmp/upload_file_data_qpUHCf', u'purge_source': True, u'type': u'file', u'to_posix_lines': True}, u'%s.bkn': {u'name': u'hard_masked_seabass_genome.bkp', u'file_type': u'spalndbnp', u'space_to_tab': False, u'uuid': None, u'dbkey': u'?', u'auto_decompress': True, u'path': u'/home/pvh/Documents/code/Masters/galaxy/database/tmp/upload_file_data_p1w3_I', u'purge_s
View gist:499f432c075ec00ad787a908d7c93943
cd client && yarn run build
yarn run v1.15.2
$ NODE_ENV=development gulp staging && concurrently -r "yarn run webpack" "yarn run gulp clean && yarn run gulp" && yarn run save-build-hash
[15:27:36] Using gulpfile /tools/software/galaxy/galaxy1/client/gulpfile.js
[15:27:36] Starting 'stage-libs'...
[15:27:36] Starting 'fonts'...
[15:27:36] Finished 'fonts' after 511 ms
$ gulp clean
$ webpack -d
[15:28:09] Using gulpfile /tools/software/galaxy/galaxy1/client/gulpfile.js
View build.log
No numpy version specified in conda_build_config.yaml. Falling back to default numpy value of 1.11
WARNING:conda_build.metadata:No numpy version specified in conda_build_config.yaml. Falling back to default numpy value of 1.11
Adding in variants from internal_defaults
INFO:conda_build.variants:Adding in variants from internal_defaults
Attempting to finalize metadata for dtoolcore
INFO:conda_build.metadata:Attempting to finalize metadata for dtoolcore
Traceback (most recent call last):
File "/usr/people/pvh/miniconda3/lib/python3.6/site-packages/urllib3/contrib/pyopenssl.py", line 280, in recv_into
return self.connection.recv_into(*args, **kwargs)
File "/usr/people/pvh/miniconda3/lib/python3.6/site-packages/OpenSSL/SSL.py", line 1814, in recv_into
View loop example
dna = 'ctgtaacttagttggctctttcgtagcccattgtcgggctagctatttcactcccgcgggggtctccgcgtggatggt'
codon1 = dna[0:3]
codon2 = dna[3:6]
codon3 = dna[6:9]
codon4 = dna[12:15]
codon5 = dna[15:18]
print(codon1)
print(codon2)
print(codon3)
print(codon4)
View test.rs
pattern_buffer[pattern_counter] = c;
output_buffer.write(&pattern_buffer[0..pattern_counter+1]).expect("failed to write pattern buffer to output file");
state = 4;
pattern_counter = 0;
View gist:ee56718b2cd4059f61a3278d0e5b7de2
Mycobacterium avium subsp. paratuberculosis K-10 GCF_000007865.1
Mycobacterium avium 104 GCF_000014985.1
Mycobacterium avium subsp. paratuberculosis MAP4 GCF_000390085.1
Mycobacterium avium subsp. avium 2285 (R) GCF_000758285.1
Mycobacterium avium subsp. avium GCF_000770235.1
Mycobacterium avium subsp. hominissuis TH135 GCF_000829075.1
Mycobacterium avium subsp. avium 2285 (S) GCF_000831285.1
Mycobacterium avium subsp. paratuberculosis GCF_000835225.1
Mycobacterium avium subsp. paratuberculosis GCF_000835265.1
Mycobacterium avium subsp. paratuberculosis GCF_001653355.1
View ERR176616.kraken2.report.txt
1.12 33870 33870 U 0 unclassified
98.88 2978494 12 R 1 root
98.87 2978389 28 R1 131567 cellular organisms
98.83 2977151 146 D 2 Bacteria
98.81 2976546 136 D1 1783272 Terrabacteria group
98.80 2976359 30 P 201174 Actinobacteria
98.80 2976326 852 C 1760 Actinobacteria
98.76 2974981 496 O 85007 Corynebacteriales
98.74 2974346 1298 F 1762 Mycobacteriaceae
98.69 2972883 2670134 G 1763 Mycobacterium
View demo.rs
let output_file = match matches.value_of("OUTPUT_FILE") {
Some(name) => fasta::Writer::new(File::create(name).expect(format!("Failed to open output file ({})", name).as_str())),
None => fasta::Writer::new(io::stdout())
};
//
// error[E0308]: match arms have incompatible types
// --> src/main.rs:42:23
// |
@pvanheus
pvanheus / patric_genomes.cli
Created Dec 9, 2018
download genomes from Genbank, using Python aiohttp
View patric_genomes.cli
#!/usr/bin/env python
import argparse
import asyncio
from pathlib import Path
import socket
import re
import pandas
from aiohttp import ClientSession, TCPConnector
View d2p2.scala
import scala.annotation.tailrec
@tailrec
def diff1(s1: String, s2: String, differences: Int): Boolean =
if (differences > 1) false
else if (s1.length == 0) {
if (differences == 1) true else false
} else
diff1(s1.substring(1),
s2.substring(1),
You can’t perform that action at this time.