Skip to content

Instantly share code, notes, and snippets.

pvanheus

Block or report user

Report or block pvanheus

Hide content and notifications from this user.

Learn more about blocking users

Contact Support about this user’s behavior.

Learn more about reporting abuse

Report abuse
View GitHub Profile
View PRJEB22237.txt
study_accession sample_accession secondary_sample_accession experiment_accession run_accession tax_id scientific_name instrument_model library_layout fastq_ftp fastq_galaxy submitted_ftp submitted_galaxy sra_ftp sra_galaxy cram_index_ftp cram_index_galaxy
PRJEB22237 SAMEA104221057 ERS1880075 ERX2157080 ERR2099775 1773 Mycobacterium tuberculosis Illumina MiSeq PAIRED ftp.sra.ebi.ac.uk/vol1/fastq/ERR209/005/ERR2099775/ERR2099775_1.fastq.gz;ftp.sra.ebi.ac.uk/vol1/fastq/ERR209/005/ERR2099775/ERR2099775_2.fastq.gz ftp.sra.ebi.ac.uk/vol1/fastq/ERR209/005/ERR2099775/ERR2099775_1.fastq.gz;ftp.sra.ebi.ac.uk/vol1/fastq/ERR209/005/ERR2099775/ERR2099775_2.fastq.gz ftp.sra.ebi.ac.uk/vol1/run/ERR209/ERR2099775/G1003mi_G249_1.filtered.fastq.gz;ftp.sra.ebi.ac.uk/vol1/run/ERR209/ERR2099775/G1003mi_G249_2.filtered.fastq.gz ftp.sra.ebi.ac.uk/vol1/run/ERR209/ERR2099775/G1003mi_G249_1.filtered.fastq.gz;ftp.sra.ebi.ac.uk/vol1/run/ERR209/ERR2099775/G1003mi_G249_2.filtered.fastq.gz ftp.sra.ebi.ac.uk/vol1/err/ERR209/005/ERR2099775 ft
View gist:d1c38c1589c309dfd4543b7ed530f424
vl = QgsVectorLayer("Point?crs=epsg:4326&field=id:integer&field=name:string(20)&index=yes", "temporary_points", "memory")
pr = vl.dataProvider()
pr.addAttributes([QgsField("name", QVariant.String), QgsField("age", QVariant.Int), QgsField("size", QVariant.Double)])
vl.updateFields()
fet = QgsFeature()
fet.setGeometry(QgsGeometry.fromPointXY(QgsPointXY(10,10)))
fet.setAttributes(["Johny", 2, 0.3])
pr.addFeatures([fet])
View galaxy.json
{"failed": true, "dataset_id": 68, "type": "dataset", "ext": "data", "stderr": "Failed to find file_path %s.bkp in {u'%s.idx': {u'name': u'hard_masked_seabass_genome.seq', u'file_type': u'spalndbnp', u'space_to_tab': False, u'uuid': None, u'dbkey': u'?', u'auto_decompress': True, u'path': u'/home/pvh/Documents/code/Masters/galaxy/database/tmp/upload_file_data_xU_6zT', u'purge_source': True, u'type': u'file', u'to_posix_lines': True}, u'%s.seq': {u'name': u'hard_masked_seabass_genome.bkn', u'file_type': u'spalndbnp', u'space_to_tab': False, u'uuid': None, u'dbkey': u'?', u'auto_decompress': True, u'path': u'/home/pvh/Documents/code/Masters/galaxy/database/tmp/upload_file_data_qpUHCf', u'purge_source': True, u'type': u'file', u'to_posix_lines': True}, u'%s.bkn': {u'name': u'hard_masked_seabass_genome.bkp', u'file_type': u'spalndbnp', u'space_to_tab': False, u'uuid': None, u'dbkey': u'?', u'auto_decompress': True, u'path': u'/home/pvh/Documents/code/Masters/galaxy/database/tmp/upload_file_data_p1w3_I', u'purge_s
View gist:499f432c075ec00ad787a908d7c93943
cd client && yarn run build
yarn run v1.15.2
$ NODE_ENV=development gulp staging && concurrently -r "yarn run webpack" "yarn run gulp clean && yarn run gulp" && yarn run save-build-hash
[15:27:36] Using gulpfile /tools/software/galaxy/galaxy1/client/gulpfile.js
[15:27:36] Starting 'stage-libs'...
[15:27:36] Starting 'fonts'...
[15:27:36] Finished 'fonts' after 511 ms
$ gulp clean
$ webpack -d
[15:28:09] Using gulpfile /tools/software/galaxy/galaxy1/client/gulpfile.js
View build.log
No numpy version specified in conda_build_config.yaml. Falling back to default numpy value of 1.11
WARNING:conda_build.metadata:No numpy version specified in conda_build_config.yaml. Falling back to default numpy value of 1.11
Adding in variants from internal_defaults
INFO:conda_build.variants:Adding in variants from internal_defaults
Attempting to finalize metadata for dtoolcore
INFO:conda_build.metadata:Attempting to finalize metadata for dtoolcore
Traceback (most recent call last):
File "/usr/people/pvh/miniconda3/lib/python3.6/site-packages/urllib3/contrib/pyopenssl.py", line 280, in recv_into
return self.connection.recv_into(*args, **kwargs)
File "/usr/people/pvh/miniconda3/lib/python3.6/site-packages/OpenSSL/SSL.py", line 1814, in recv_into
View loop example
dna = 'ctgtaacttagttggctctttcgtagcccattgtcgggctagctatttcactcccgcgggggtctccgcgtggatggt'
codon1 = dna[0:3]
codon2 = dna[3:6]
codon3 = dna[6:9]
codon4 = dna[12:15]
codon5 = dna[15:18]
print(codon1)
print(codon2)
print(codon3)
print(codon4)
View test.rs
pattern_buffer[pattern_counter] = c;
output_buffer.write(&pattern_buffer[0..pattern_counter+1]).expect("failed to write pattern buffer to output file");
state = 4;
pattern_counter = 0;
View gist:ee56718b2cd4059f61a3278d0e5b7de2
Mycobacterium avium subsp. paratuberculosis K-10 GCF_000007865.1
Mycobacterium avium 104 GCF_000014985.1
Mycobacterium avium subsp. paratuberculosis MAP4 GCF_000390085.1
Mycobacterium avium subsp. avium 2285 (R) GCF_000758285.1
Mycobacterium avium subsp. avium GCF_000770235.1
Mycobacterium avium subsp. hominissuis TH135 GCF_000829075.1
Mycobacterium avium subsp. avium 2285 (S) GCF_000831285.1
Mycobacterium avium subsp. paratuberculosis GCF_000835225.1
Mycobacterium avium subsp. paratuberculosis GCF_000835265.1
Mycobacterium avium subsp. paratuberculosis GCF_001653355.1
View ERR176616.kraken2.report.txt
1.12 33870 33870 U 0 unclassified
98.88 2978494 12 R 1 root
98.87 2978389 28 R1 131567 cellular organisms
98.83 2977151 146 D 2 Bacteria
98.81 2976546 136 D1 1783272 Terrabacteria group
98.80 2976359 30 P 201174 Actinobacteria
98.80 2976326 852 C 1760 Actinobacteria
98.76 2974981 496 O 85007 Corynebacteriales
98.74 2974346 1298 F 1762 Mycobacteriaceae
98.69 2972883 2670134 G 1763 Mycobacterium
View demo.rs
let output_file = match matches.value_of("OUTPUT_FILE") {
Some(name) => fasta::Writer::new(File::create(name).expect(format!("Failed to open output file ({})", name).as_str())),
None => fasta::Writer::new(io::stdout())
};
//
// error[E0308]: match arms have incompatible types
// --> src/main.rs:42:23
// |
You can’t perform that action at this time.