Skip to content

Instantly share code, notes, and snippets.

pvanheus

Block or report user

Report or block pvanheus

Hide content and notifications from this user.

Learn more about blocking users

Contact Support about this user’s behavior.

Learn more about reporting abuse

Report abuse
View GitHub Profile
View snp_msa.fasta
>MTB_anc foo
CCCCGGGAGCCCGGTAGGCCGTCGGATGCGTCCCGCCCGGCGCGCCGTCCGCCACTCGGT
CGCACGCCCGGCCGGCCCCTAATGTTCGGCCACACCGAGCGGGCGAGAGGGGTGACTCGG
AGTCCCGGAGGCCGCCCCGGCCGAGTGCGTCGCCCACGCCGCGGCTTCCATGTGACATGC
TGGCCGAGCAGACAGAAGACGGGACGATCGCCCTCACGCGCGGGGGACCCGTGTGCAGGT
CCGGGGCCCGCAAGGCGACATGCCAACGGGCTTACACCCAATCTCCGCTGCTGTCCGCCA
ACACACGGTATTCCCCGGCGCGCCAGCCACGGGCTCTGGAGAACACCCATGACGGGGCGC
CCCGGCGCCCCCCCACGGAGAGGTACCGCCGCGGGAGCTCAGGGGGGCAGTTCTGGCCCT
ACGGAGGGCGGCTGTAGCCCGCCCTCTGCCCGAGCGGAGTCTCGGGGGCGGCGGGGACCT
CCGGATGCGTCTCTGAGGAGGTCTCGCGCCGCGTAGTTTGGTCTCAGCGCGACTGCGCCC
View kraken2.cwl
#!/usr/bin/env cwl-runner
cwlVersion: v1.0
class: CommandLineTool
id: kraken2
baseCommand:
- kraken2
inputs:
database:
type:
- Directory
View manipulating_data.R
library(tidyverse)
surveys <- read_csv("data_raw/portal_data_joined.csv")
str(surveys)
select(surveys, plot_id, species_id, weight)
select(surveys, -record_id, -species_id)
filter(surveys, year == 1995)
surveys2 <- filter(surveys, weight < 5)
View starting_with_data.R
download.file(url = "https://ndownloader.figshare.com/files/2292169",
destfile = "data_raw/portal_data_joined.csv")
getwd() # show where I am
surveys <- read.csv("data_raw/portal_data_joined.csv")
head(surveys)
View(surveys)
weight_g <- c(10, 50, 30)
View cluster.yaml
__default__:
nCPUs : 1
memory : 10000
name : "mykrobe.{rule}.{wildcards}"
output : "logs/cluster_{rule}.{wildcards}.o"
error : "logs/cluster_{rule}.{wildcards}.e"
map_minimap2:
nCPUs : 16
View porechop.cwl
class: CommandLineTool
cwlVersion: v1.0
$namespaces:
s: 'http://schema.org/'
baseCommand:
- porechop
inputs:
output_format:
type:
- 'null'
View PRJEB22237.txt
study_accession sample_accession secondary_sample_accession experiment_accession run_accession tax_id scientific_name instrument_model library_layout fastq_ftp fastq_galaxy submitted_ftp submitted_galaxy sra_ftp sra_galaxy cram_index_ftp cram_index_galaxy
PRJEB22237 SAMEA104221057 ERS1880075 ERX2157080 ERR2099775 1773 Mycobacterium tuberculosis Illumina MiSeq PAIRED ftp.sra.ebi.ac.uk/vol1/fastq/ERR209/005/ERR2099775/ERR2099775_1.fastq.gz;ftp.sra.ebi.ac.uk/vol1/fastq/ERR209/005/ERR2099775/ERR2099775_2.fastq.gz ftp.sra.ebi.ac.uk/vol1/fastq/ERR209/005/ERR2099775/ERR2099775_1.fastq.gz;ftp.sra.ebi.ac.uk/vol1/fastq/ERR209/005/ERR2099775/ERR2099775_2.fastq.gz ftp.sra.ebi.ac.uk/vol1/run/ERR209/ERR2099775/G1003mi_G249_1.filtered.fastq.gz;ftp.sra.ebi.ac.uk/vol1/run/ERR209/ERR2099775/G1003mi_G249_2.filtered.fastq.gz ftp.sra.ebi.ac.uk/vol1/run/ERR209/ERR2099775/G1003mi_G249_1.filtered.fastq.gz;ftp.sra.ebi.ac.uk/vol1/run/ERR209/ERR2099775/G1003mi_G249_2.filtered.fastq.gz ftp.sra.ebi.ac.uk/vol1/err/ERR209/005/ERR2099775 ft
View gist:d1c38c1589c309dfd4543b7ed530f424
vl = QgsVectorLayer("Point?crs=epsg:4326&field=id:integer&field=name:string(20)&index=yes", "temporary_points", "memory")
pr = vl.dataProvider()
pr.addAttributes([QgsField("name", QVariant.String), QgsField("age", QVariant.Int), QgsField("size", QVariant.Double)])
vl.updateFields()
fet = QgsFeature()
fet.setGeometry(QgsGeometry.fromPointXY(QgsPointXY(10,10)))
fet.setAttributes(["Johny", 2, 0.3])
pr.addFeatures([fet])
View galaxy.json
{"failed": true, "dataset_id": 68, "type": "dataset", "ext": "data", "stderr": "Failed to find file_path %s.bkp in {u'%s.idx': {u'name': u'hard_masked_seabass_genome.seq', u'file_type': u'spalndbnp', u'space_to_tab': False, u'uuid': None, u'dbkey': u'?', u'auto_decompress': True, u'path': u'/home/pvh/Documents/code/Masters/galaxy/database/tmp/upload_file_data_xU_6zT', u'purge_source': True, u'type': u'file', u'to_posix_lines': True}, u'%s.seq': {u'name': u'hard_masked_seabass_genome.bkn', u'file_type': u'spalndbnp', u'space_to_tab': False, u'uuid': None, u'dbkey': u'?', u'auto_decompress': True, u'path': u'/home/pvh/Documents/code/Masters/galaxy/database/tmp/upload_file_data_qpUHCf', u'purge_source': True, u'type': u'file', u'to_posix_lines': True}, u'%s.bkn': {u'name': u'hard_masked_seabass_genome.bkp', u'file_type': u'spalndbnp', u'space_to_tab': False, u'uuid': None, u'dbkey': u'?', u'auto_decompress': True, u'path': u'/home/pvh/Documents/code/Masters/galaxy/database/tmp/upload_file_data_p1w3_I', u'purge_s
View gist:499f432c075ec00ad787a908d7c93943
cd client && yarn run build
yarn run v1.15.2
$ NODE_ENV=development gulp staging && concurrently -r "yarn run webpack" "yarn run gulp clean && yarn run gulp" && yarn run save-build-hash
[15:27:36] Using gulpfile /tools/software/galaxy/galaxy1/client/gulpfile.js
[15:27:36] Starting 'stage-libs'...
[15:27:36] Starting 'fonts'...
[15:27:36] Finished 'fonts' after 511 ms
$ gulp clean
$ webpack -d
[15:28:09] Using gulpfile /tools/software/galaxy/galaxy1/client/gulpfile.js
You can’t perform that action at this time.