This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/bin/sh | |
COMBATTB_DATA=https://zenodo.org/record/51638/files/combat_tb_neo4j.tar.bz2 | |
if [ ! -d /srv -o ! -w /srv ] ; then | |
echo "A directory called /srv must exist and be writeable by your user before using this script." >&2 | |
fi | |
( if [ ! -d /srv/neo4j ] ; then mkdir -p /srv/neo4j ; fi ; cd /srv/neo4j ; wget -c -O combattb_data.tar.bz2 https://zenodo.org/record/51638/files/combat_tb_neo4j.tar.bz2 ; tar xf combattb_data.tar.bz2 ) | |
docker-compose up --build |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
rewritten text: | |
We report here the ~670 Mb genome get together of the Asian seabass (Lates calcarifer), a tropical marine teleost. We utilized long-read sequencing increased by transcriptomics, optical and hereditary mapping alongside shared synteny from firmly related fish species to infer a chromosome-level get together with a contig N50 size more than 1 Mb and framework N50 size more than 25 Mb that traverse ~90% of the genome. The populace structure of L. calcarifer species complex was investigated by re-sequencing 61 people speaking to different areas over the species' local reach. SNP investigations distinguished elevated amounts of hereditary differing qualities and affirmed before signs of a populace stratification including three clades with indications of admixture evident in the South-East Asian populace. The nature of the Asian seabass genome get together far surpasses that of whatever other fish species, and will serve as another standard for fish genomics. | |
original: | |
We report here the ~670 Mb |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
127.0.0.1 - - [09/Jun/2016:20:01:00 +0200] "GET /admin_toolshed/manage_repository?sort=name&id=f2db41e1fa331b3e&f-deleted=False HTTP/1.1" 200 - "http://localhost:8080/admin_toolshed/browse_repositories" "Mozilla/5.0 (X11; Linux x86_64) AppleWebKit/537.36 (KHTML, like Gecko) Chrome/51.0.2704.79 Safari/537.36" | |
..... | |
Error: No packages found in current linux-64 channels matching: ncbi_blast_plus | |
You can search for this package on anaconda.org with | |
anaconda search -t conda ncbi_blast_plus | |
You may need to install the anaconda-client command line client with |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<dependency_resolvers> | |
<!-- the default configuration, first look for dependencies installed from the toolshed --> | |
<tool_shed_packages /> | |
<!-- then look for env.sh files in directories according to the "galaxy packages" schema. | |
These resolvers can take a base_path attribute to specify where to look for | |
package definitions, but by default look in the directory specified by tool_dependency_dir | |
in Galaxy's config/galaxy.ini --> | |
<galaxy_packages /> | |
<galaxy_packages versionless="true" /> | |
<conda auto_install="true" auto_init="true" /> |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
TTGACCGATGACCCCGGTTCAGGCTTCACCACAGTGTGGAACGCGGTCGTCTCCGAACTTAACGGCGACC | |
CTAAGGTTGACGACGGACCCAGCAGTGATGCTAATCTCAGCGCTCCGCTGACCCCTCAGCAAAGGGCTTG | |
GCTCAATCTCGTCCAGCCATTGACCATCGTCGAGGGGTTTGCTCTGTTATCCGTGCCGAGCAGCTTTGTC | |
CAAAACGAAATCGAGCGCCATCTGCGGGCCCCGATTACCGACGCTCTCAGCCGCCGACTCGGACATCAGA | |
TCCAACTCGGGGTCCGCATCGCTCCGCCGGCGACCGACGAAGCCGACGACACTACCGTGCCGCCTTCCGA | |
AAATCCTGCTACCACATCGCCAGACACCACAACCGACAACGACGAGATTGATGACAGCGCTGCGGCACGG | |
GGCGATAACCAGCACAGTTGGCCAAGTTACTTCACCGAGCGCCCGCACAATACCGATTCCGCTACCGCTG | |
GCGTAACCAGCCTTAACCGTCGCTACACCTTTGATACGTTCGTTATCGGCGCCTCCAACCGGTTCGCGCA | |
CGCCGCCGCCTTGGCGATCGCAGAAGCACCCGCCCGCGCTTACAACCCCCTGTTCATCTGGGGCGAGTCC | |
GGTCTCGGCAAGACACACCTGCTACACGCGGCAGGCAACTATGCCCAACGGTTGTTCCCGGGAATGCGGG |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
EBUG:conda.config:Could not import binstar | |
DEBUG:conda.fetch:channel_urls=() | |
INFO:stdoutlog:Fetching package metadata: | |
DEBUG:requests.packages.urllib3.util.retry:Converted retries value: 3 -> Retry(total=3, connect=None, read=None, redirect=None) | |
INFO:stdoutlog: | |
DEBUG:conda.fetch:adding cached pkg to index: python-2.7.11-0.tar.bz2 | |
DEBUG:conda.fetch:adding cached pkg to index: sqlite-3.13.0-0.tar.bz2 | |
DEBUG:conda.fetch:adding cached pkg to index: pandas-0.18.1-np111py27_0.tar.bz2 | |
DEBUG:conda.fetch:adding cached pkg to index: pip-8.1.1-py27_1.tar.bz2 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Fatal error: Matched on Error: | |
discarding /home/galaxy/galaxydemo/shed_tools/_conda/bin from PATH | |
prepending /home/galaxy/galaxydemo/galaxy/database/jobs/000/36/conda-env/bin to PATH | |
Error: no such directory: /home/galaxy/galaxydemo/galaxy/database/jobs/000/36/conda-metadata-env/bin | |
then in logs: | |
galaxy.tools.deps.conda_util DEBUG 2016-06-15 08:40:42,272 XXX: path is: /home/galaxy/galaxydemo/galaxy/database/jobs/000/36/conda-metadata-env False | |
galaxy.tools.deps.conda_util DEBUG 2016-06-15 08:40:42,273 XXX: create_args ['--unknown', '--offline', '--prefix', '/home/galaxy/galaxydemo/galaxy/database/jobs/000/36/conda-metadata-env', '--file', '/home/galaxy/galaxydemo/galaxy/database/tmp/jobdepsx31qdza70136bd6dae458367ccc8b3f4d5afbba0945abf8821362f9e05e4ff593adbcf/__package__samtools@__unversioned__', '>', '/dev/null'] | |
Error: too few arguments, must supply command line package specs or --file |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<!DOCTYPE html> | |
<html> | |
<head> | |
<meta charset="utf-8"> | |
<title>COMBAT-TB</title> | |
<!-- meta --> | |
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8"/> | |
<meta name="viewport" content="width=device-width, initial-scale=1, maximum-scale=1.0"/> | |
<!-- styles --> | |
<link href="https://fonts.googleapis.com/icon?family=Material+Icons" rel="stylesheet"> |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
var TestBox = React.createClass({ | |
getInitialState: function () { | |
return {enabled: false, othervalue: ''} | |
}, | |
componentDidMount: function() { | |
$(document).ready(function() { | |
$('select').material_select(); | |
}); | |
$('#staticselect').material_select(this._handleSelectChange.bind(this)); |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
var TestBox = React.createClass({ | |
getInitialState: function () { | |
return {enabled: false, othervalue: ''} | |
}, | |
componentDidMount: function() { | |
$(document).ready(function() { | |
$('select').material_select(); | |
}); | |
// $('#staticselect').material_select(this._handleSelectChange.bind(this)); |