Skip to content

Instantly share code, notes, and snippets.

View pwwang's full-sized avatar
🏠
Github addictive user

pwwang

🏠
Github addictive user
View GitHub Profile
@pwwang
pwwang / office-activation.md
Created June 5, 2024 18:49 — forked from devomman/activate-office-windows-mac.md
Office Activation Command by Omman

Office 2021

Method 1: Using my command line

Step 1.1: Open cmd program with administrator rights.

  • First, you need to open cmd in the admin mode, then run all commands below one by one.

Step 1.2: Get into the Office directory in cmd.

  • For x86 and x64
cd /d %ProgramFiles(x86)%\Microsoft Office\Office16
cd /d %ProgramFiles%\Microsoft Office\Office16
@pwwang
pwwang / whichpy.fish
Last active October 15, 2023 21:12
Check the information for a python package
# ~/.config/fish/functions/whichpy.fish
function whichpy --description 'Print python package information'
set -l whichpy_script_url "https://gist.githubusercontent.com/pwwang/879966128b0408c2459eb0a0b413fa69/raw/01fdd16e690a015aaa1015edf8874a6986bd33af/whichpy.py"
set -l whichpy_script /tmp/whichpy.py
if not test -f "$whichpy_script"
echo "Downloading: $whichpy_script_url"
command curl -sS "$whichpy_script_url" -o "$whichpy_script"
end
if test (count $argv) -eq 0
echo "Usage: whichpy <package> [python]"
@pwwang
pwwang / poetry-editable.fish
Last active April 14, 2023 18:52
Install local python package in editable mode managed by poetry
function poetry-editable --description 'Do editable install for poetry project'
echo "= RUN poetry build"
poetry build
set ver (poetry version -s)
pushd dist/
tar zxvf *-$ver.tar.gz
popd
mv setup.py setup.py.bak
function on_premature_exit
@pwwang
pwwang / sift4g_annotator
Created June 11, 2020 19:41
Wrapper script for SIFT4G_Annotator
#!/usr/bin/env python
#
# Wrapper script for SIFT4G_annotator
#
#
# Program Parameters
#
import os
import subprocess
@pwwang
pwwang / Makefile
Created September 28, 2019 00:27
A proxy Makefile to subdirectory's Makefile
# get all targets from subdirectory
SUBDIR := subdir
TARGETS := $(shell make -C $(SUBDIR) -rpn | sed -n -e "/^$$/ { n ; /^[^ .\#%][^ ]\*:/ { s/:.\*$$// ; p ; } ; }" )
# default target
all:
# pass all targets to subdirectory
%:
@pwwang
pwwang / vcf2maf.pl
Created September 24, 2018 18:44
vcf2maf.pl with logs
#!/usr/bin/env perl
# vcf2maf - Convert a VCF into a MAF by mapping each variant to only one of all possible gene isoforms
use strict;
use warnings;
use IO::File;
use Getopt::Long qw( GetOptions );
use Pod::Usage qw( pod2usage );
use File::Path qw( mkpath );
@pwwang
pwwang / __fish_move_last.fish
Last active July 5, 2018 19:55
Fish cd with symbolic path kept.
# for prevd and nextd, cd -
function __fish_move_last -d "Move the last element of a directory history from src to dest"
set -l src $argv[1]
set -l dest $argv[2]
set -l size_src (count $$src)
if test $size_src = 0
# Cannot make this step
Windows Registry Editor Version 5.00
; Created by: Shawn Brink
; http://www.sevenforums.com
; Tutorial: http://www.sevenforums.com/tutorials/47415-open-command-window-here-administrator.html
[-HKEY_CLASSES_ROOT\Directory\shell\runas]
@pwwang
pwwang / qst
Last active November 4, 2023 01:54
qstat with full job name
#!/usr/bin/env python
from subprocess import check_output
from re import search
cmd = ['qstat', '-xml']
# get the xml output
output = check_output (cmd)
keys = [] # the feature names
vals = [] # the jobs including all features
job = [] # the features
@pwwang
pwwang / testPE1.sam
Last active July 10, 2017 23:47
Testing reads
This file has been truncated, but you can view the full file.
@HD VN:1.4 SO:coordinate
@SQ SN:chrPhage LN:48502
@RG ID:testPE1.L1 PU:unit1 LB:lib1 SM:testPE1 PL:Illumina
@PG ID:bwa PN:bwa VN:0.7.15-r1140 CL:bwa mem -t 1 -R @RG\tID:testPE1.L1\tPU:unit1\tLB:lib1\tSM:testPE1\tPL:Illumina ./data/lambda_virus.fa /data2/junwenwang/panwen/tools/bioprocs/tests/workdir/PyPPL.pFastqPE2SamData.sambam.20pe9DUu/1/input/testPE1_1.fq /data2/junwenwang/panwen/tools/bioprocs/tests/workdir/PyPPL.pFastqPE2SamData.sambam.20pe9DUu/1/input/testPE1_2.fq
@PG ID:bamsort PN:bamsort CL:bamsort I=/data2/junwenwang/panwen/tools/bioprocs/tests/workdir/PyPPL.pSam2BamData.sambam.hl9sPcM2/1/input/testPE1.sam O=/data2/junwenwang/panwen/tools/bioprocs/tests/workdir/PyPPL.pSam2BamData.sambam.hl9sPcM2/1/output/testPE1.bam SO=coordinate blockme=16384 tmpfile=/tmp/pSam2BamData.testPE1.1/tmp. inputformat=sam outformat=bam inputthreads=1 outputthreads=1 markduplicates=0 rmdup=0 PP:bwa VN:2.0.72
r92 2145 chrPhage 1 60 273H42M = 43 244 GGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTC A5)?.3E8,=E*1F4/"F50>9/#H'=A:/$G9)