View whichpy.fish
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# ~/.config/fish/functions/whichpy.fish | |
function whichpy --description 'Print python package information' | |
set -l whichpy_script_url "https://gist.githubusercontent.com/pwwang/879966128b0408c2459eb0a0b413fa69/raw/4e3d29ffc580f62182f45f50d4feee3b58c6b633/whichpy.py" | |
set -l whichpy_script /tmp/whichpy.py | |
if not test -f "$whichpy_script" | |
echo "Downloading: $whichpy_script_url" | |
command curl -sS "$whichpy_script_url" -o "$whichpy_script" | |
end | |
if test (count $argv) -eq 0 | |
echo "Usage: whichpy <package> [python]" |
View poetry-editable.fish
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
function poetry-editable --description 'Do editable install for poetry project' | |
echo "= RUN poetry build" | |
poetry build | |
set ver (poetry version -s) | |
pushd dist/ | |
tar zxvf *-$ver.tar.gz | |
popd | |
mv setup.py setup.py.bak | |
function on_premature_exit |
View sift4g_annotator
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python | |
# | |
# Wrapper script for SIFT4G_annotator | |
# | |
# | |
# Program Parameters | |
# | |
import os | |
import subprocess |
View Makefile
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# get all targets from subdirectory | |
SUBDIR := subdir | |
TARGETS := $(shell make -C $(SUBDIR) -rpn | sed -n -e "/^$$/ { n ; /^[^ .\#%][^ ]\*:/ { s/:.\*$$// ; p ; } ; }" ) | |
# default target | |
all: | |
# pass all targets to subdirectory | |
%: |
View vcf2maf.pl
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env perl | |
# vcf2maf - Convert a VCF into a MAF by mapping each variant to only one of all possible gene isoforms | |
use strict; | |
use warnings; | |
use IO::File; | |
use Getopt::Long qw( GetOptions ); | |
use Pod::Usage qw( pod2usage ); | |
use File::Path qw( mkpath ); |
View __fish_move_last.fish
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
# for prevd and nextd, cd - | |
function __fish_move_last -d "Move the last element of a directory history from src to dest" | |
set -l src $argv[1] | |
set -l dest $argv[2] | |
set -l size_src (count $$src) | |
if test $size_src = 0 | |
# Cannot make this step |
View Add_Open_Command_Window_Here_as_Administrator.reg
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Windows Registry Editor Version 5.00 | |
; Created by: Shawn Brink | |
; http://www.sevenforums.com | |
; Tutorial: http://www.sevenforums.com/tutorials/47415-open-command-window-here-administrator.html | |
[-HKEY_CLASSES_ROOT\Directory\shell\runas] |
View qst
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python | |
from subprocess import check_output | |
from re import search | |
cmd = ['qstat', '-xml'] | |
# get the xml output | |
output = check_output (cmd) | |
keys = [] # the feature names | |
vals = [] # the jobs including all features | |
job = [] # the features |
View testPE1.sam
This file has been truncated, but you can view the full file.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
@HD VN:1.4 SO:coordinate | |
@SQ SN:chrPhage LN:48502 | |
@RG ID:testPE1.L1 PU:unit1 LB:lib1 SM:testPE1 PL:Illumina | |
@PG ID:bwa PN:bwa VN:0.7.15-r1140 CL:bwa mem -t 1 -R @RG\tID:testPE1.L1\tPU:unit1\tLB:lib1\tSM:testPE1\tPL:Illumina ./data/lambda_virus.fa /data2/junwenwang/panwen/tools/bioprocs/tests/workdir/PyPPL.pFastqPE2SamData.sambam.20pe9DUu/1/input/testPE1_1.fq /data2/junwenwang/panwen/tools/bioprocs/tests/workdir/PyPPL.pFastqPE2SamData.sambam.20pe9DUu/1/input/testPE1_2.fq | |
@PG ID:bamsort PN:bamsort CL:bamsort I=/data2/junwenwang/panwen/tools/bioprocs/tests/workdir/PyPPL.pSam2BamData.sambam.hl9sPcM2/1/input/testPE1.sam O=/data2/junwenwang/panwen/tools/bioprocs/tests/workdir/PyPPL.pSam2BamData.sambam.hl9sPcM2/1/output/testPE1.bam SO=coordinate blockme=16384 tmpfile=/tmp/pSam2BamData.testPE1.1/tmp. inputformat=sam outformat=bam inputthreads=1 outputthreads=1 markduplicates=0 rmdup=0 PP:bwa VN:2.0.72 | |
r92 2145 chrPhage 1 60 273H42M = 43 244 GGGCGGCGACCTCGCGGGTTTTCGCTATTTATGAAAATTTTC A5)?.3E8,=E*1F4/"F50>9/#H'=A:/$G9) |