Skip to content

Instantly share code, notes, and snippets.

Avatar

Riley Doyle rodoyle

View GitHub Profile
@rodoyle
rodoyle / keybase.md
Created Apr 9, 2018
Keybase Verification
View keybase.md

Keybase proof

I hereby claim:

  • I am rodoyle on github.
  • I am rodoyle (https://keybase.io/rodoyle) on keybase.
  • I have a public key ASBWc24N_GNu5SVP5eCXHYJyj1uXVx3fxDwK2trFOzG8zQo

To claim this, I am signing this object:

@rodoyle
rodoyle / sxsw-2017.py
Created Mar 11, 2017
Building a custom genome
View sxsw-2017.py
#!/opt/venvs/deskgen/bin/python
"""
Script to build genome, call variants, patch, and score
"""
import logging
import multiprocessing
import os
import sys
View trac-anti-cd19-donor.py
#!/usr/bin/python
import sys
#DNA PARTS
LITR = 'CCTGCAGGCAGCTGCGCGCTCGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCCCGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGGTTCCT'
RITR = 'AGGAACCCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGGGCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGAGCGCGCAGCTGCCTGCAGG'
POLYA = 'ACGGGTGGCATCCCTGTGACCCCTCCCCAGTGCCTCTCCTGGCCCTGGAAGTTGCCACTCCAGTGCCCACCAGCCTTGTCCTAATAAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATAATATTATGGGGTGGAGGGGGGTGGTATGGAGCAAGGGGCAAGTTGGGAAGACAACCTGTAGGGCCTGCGGGGTCTATTGGGAACCAAGCTGGAGTGCAGTGGCACAATCTTGGCTCACTGCAATCTCCGCCTCCTGGGTTCAAGCGATTCTCCTGCCTCAGCCTCCCGAGTTGTTGGGATTCCAGGCATGCATGACCAGGCTCAGCTAATTTTTGTTTTTTTGGTAGAGACGGGGTTTCACCATATTGGCCAGGCTGGTCTCCAACTCCTAATCTCAGGTGATCTACCCACCTTGGCCTCCCAAATTGCTGGGATTACAGGCGTGAACCACTGCTCCCTTCCCTGTCCTT'
CAR = 'ccatggctctcccagtgactgccctactgcttcccctagcgcttctcctgcatgcagaggtgaagctgcagcagtctggggctgagctggtgaggcctgggtcctcagtgaagatttcctgcaaggcttctggctatgcattcagtagctactggatgaactgggtgaagcagaggcctgga