Skip to content

Instantly share code, notes, and snippets.

@roryk
Created Dec 22, 2014
Embed
What would you like to do?
>chrM
GTTAATGTAGCTTAATAACAAAGCAAAGCACTGAAAATGCTTAGATGGAT
AATTGTATCCCATAAACACAAAGGTTTGGTCCTGGCCTTATAATTAATTA
GAGGTAAAATTACACATGCAAACCTCCATAGACCGGTGTAAAATCCCTTA
AACATTTACTTAAAATTTAAGGAGAGGGTATCAAGCACATTAAAATAGCT
TAAGACACCTTGCCTAGCCACACCCCCACGGGACTCAGCAGTGATAAATA
TTAAGCAATAAACGAAAGTTTGACTAAGTTATACCTCTTAGGGTTGGTAA
ATTTCGTGCCAGCCACCGCGGTCATACGATTAACCCAAACTAATTATCTT
CGGCGTAAAACGTGTCAACTATAAATAAATAAATAGAATTAAAATCCAAC
TTATATGTGAAAATTCATTGTTAGGACCTAAACTCAATAACGAAAGTAAT
TCTAGTCATTTATAATACACGACAGCTAAGACCCAAACTGGGATTAGATA
CCCCACTATGCTTAGCCATAAACCTAAATAATTAAATTTAACAAAACTAT
TTGCCAGAGAACTACTAGCCATAGCTTAAAACTCAAAGGACTTGGCGGTA
CTTTATATCCATCTAGAGGAGCCTGTTCTATAATCGATAAACCCCGCTCT
ACCTCACCATCTCTTGCTAATTCAGCCTATATACCGCCATCTTCAGCAAA
CCCTAAAAAGGTATTAAAGTAAGCAAAAGAATCAAACATAAAAACGTTAG
GTCAAGGTGTAGCCAATGAAATGGGAAGAAATGGGCTACATTTTCTTATA
AAAGAACATTACTATACCCTTTATGAAACTAAAGGACTAAGGAGGATTTA
GTAGTAAATTAAGAATAGAGAGCTTAATTGAATTGAGCAATGAAGTACGC
ACACACCGCCCGTCACCCTCCTCAAATTAAATTAAACTTAACATAATTAA
TTTCTAGACATCCGTTTATGAGAGGAGATAAGTCGTAACAAGGTAAGCAT
ACTGGAAAGTGTGCTTGGAATAATCATAGTGTAGCTTAATATTAAAGCAT
CTGGCCTACACCCAGAAGATTTCATGACCAATGAACACTCTGAACTAATC
CTAGCCCTAGCCCTACACAAATATAATTATACTATTATATAAATCAAAAC
ATTTATCCTACTAAAAGTATTGGAGAAAGAAATTCGTACATCTAGGAGCT
ATAGAACTAGTACCGCAAGGGAAAGATGAAAGACTAATTAAAAGTAAGAA
CAAGCAAAGATTAAACCTTGTACCTTTTGCATAATGAACTAACTAGAAAA
CTTCTAACTAAAAGAATTACAGCTAGAAACCCCGAAACCAAACGAGCTAC
CTAAAAACAATTTTATGAATCAACTCGTCTATGTGGCAAAATAGTGAGAA
GATTTTTAGGTAGAGGTGAAAAGCCTAACGAGCTTGGTGATAGCTGGTTA
CCCAAAAAATGAATTTAAGTTCAATTTTAAACTTGCTAAAAAAACAACAA
AATCAAAAAGTAAGTTTAGATTATAGCCAAAAGAGGGACAGCTCTTCTGG
AACGGAAAAAACCTTTAATAGTGAATAATTAACAAAACAGCTTTTAACCA
TTGTAGGCCTAAAAGCAGCCACCAATAAAGAAAGCGTTCAAGCTCAACAT
AAAATTTCAATTAATTCCATAATTTACACCAACTTCCTAAACTTAAAATT
GGGTTAATCTATAACTTTATAGATGCAACACTGTTAGTATGAGTAACAAG
AATTCCAATTCTCCAGGCATACGCGTATAACAACTCGGATAACCATTGTT
AGTTAATCAGACTATAGGCAATAATCACACTATAAATAATCCACCTATAA
CTTCTCTGTTAACCCAACACCGGAATGCCTAAAGGAAAGATCCAAAAAGA
TAAAAGGAACTCGGCAAACAAGAACCCCGCCTGTTTACCAAAAACATCAC
CTCTAGCATTACAAGTATTAGAGGCACTGCCTGCCCAGTGACTAAAGTTT
aacggccgcggtatcctgaccgtgcaaaggtagcataatcacttgttcct
taattagggactagcatgaacggctaaacgagggtccaactgtctcttat
ctttaatcagtgaaattgacctttcagtgaagaggctgaaatataataat
aagacgagaagaccctatggagcttaaATTATATAACTTATCTATTTAAT
TTATTAAACCTAATGGCCCAAAAACTATAGTATAAGTTTGAAATTTCGGT
TGGGGTGACCTCGGAGAATAAAAAATCCTCCGAATGATTATAACCTAGAC
TTACAAGTCAAAGTAAAATCAACATATCTTATTGACCCAGATATATTTTG
ATCAACGGACCAAGTTACCCTAGGGATAACAGCGCAATCCTATTTAAGAG
TTCATATCGACAATTAGGGTTTACGACCTCGATGTTGGATCAGGACATCC
CAATGGTGTAGAAGCTATTAATGGTTCGTTTGTTCAACGATTAAAGTCCT
ACGTGATCTGAGTTCAGACCGGAGCAATCCAGGTCGGTTTCTATCTATTT
ACGATTTCTCCCAGTACGAAAGGACAAGAGAAATAGAGCCACCTTACAAA
TAAGCGCTCTCAACTTAATTTATGAATAAAATCTAAATAAAATATATACG
TACACCCTCTAACCTAGAGAAGGTTAttagggtggcagagccaggaaatt
gcgtaagacttaaaaccttgttcccagaggttcaaatcctctccctaata
GTGTTCTTTATTAATATCCTAACACTCCTCGTCCCCATTCTAATCGCCAT
AGCCTTCCTAACATTAGTAGAACGCAAAATCTTAGGGTACATACAACTAC
GAAAAGGCCCTAACATTGTTGGTCCATACGGCATTTTACAACCATTTGCA
GACGCCATAAAATTATTTATAAAAGAACCAATACGCCCTTTAACAACCTC
TATATCCTTATTTATTATTGCACCTACCCTATCACTCACACTAGCATTAA
GTCTATGAGTTCCCCTACCAATACCACACCCATTAATTAATTTAAACCTA
GGGATTTTATTTATTTTAGCAACATCTAGCCTATCAGTTTACTCCATTCT
ATGATCAGGATGAGCCTCAAACTCCAAATACTCACTATTCGGAGCTTTAC
GAGCCGTAGCCCAAACAATTTCATATGAAGTAACCATAGCTATTATCCTT
TTATCAGTTCTATTAATAAATGGATCCTACTCTCTACAAACACTTATTAC
AACCCAAGAACACATATGATTACTTCTGCCAGCCTGACCCATAGCCATAA
TATGATTTATCTCAACCCTAGCAGAAACAAACCGGGCCCCCTTCGACCTG
ACAGAAGGAGAATCAGAATTAGTATCAGGGTTTAACGTAGAATACGCAGC
CGGCCCATTCGCGTTATTCTTTATAGCAGAGTACACTAACATTATTCTAA
TAAACGCCCTAACAACTATTATCTTCCTAGGACCCCTATACTATATCAAT
TTACCAGAACTCTACTCAACTAACTTCATAATAGAAGCTCTACTACTATC
ATCAACATTCCTATGGATCCGAGCATCTTATCCACGCTTCCGTTACGATC
AACTTATACATCTTCTATGAAAAAACTTTCTACCCCTAACACTAGCATTA
TGTATGTGACATATTTCTTTACCAATTTTTACAGCGGGAGTACCACCATA
CATATAGAAATATGTCTGATAAAAGAATTACTTTGATAGAGTAAATTATA
GAGGTTCAAGCCCTCTTATTTctaggacaataggaattgaacctacactt
aagaattcaaaattctccgtgctacctaaacaccttatcctaATAGTAAG
GTCAGCTAATTAAGCTATCGGGCCCATACCCCGAAAACGTTGGTTTAAAT
CCTTCCCGTACTAATAAATCCTATCACCCTTGCCATCATCTACTTCACAA
TCTTCTTAGGTCCTGTAATCACAATATCCAGCACCAACCTAATACTAATA
TGAGTAGGCCTGGAATTCAGCCTACTAGCAATTATCCCCATACTAATCAA
CAAAAAAAACCCACGATCAACTGAAGCAGCAACAAAATACTTCGTCACAC
AAGCAACAGCCTCAATAATTATCCTCCTGGCCATCGTACTCAACTATAAA
CAACTAGGAACATGAATATTTCAACAACAAACAAACGGTCTTATCCTTAA
CATAACATTAATAGCCCTATCCATAAAACTAGGCCTCGCCCCATTCCACT
TCTGATTACCAGAAGTAACTCAAGGGATCCCACTGCACATAGGACTTATT
CTTCTTACATGACAAAAAATTGCTCCCCTATCAATTTTAATTCAAATTTA
CCCGCTACTCAACTCTACTATCATTTTAATACTAGCAATTACTTCTATTT
TCATAGGGGCATGAGGAGGACTTAACCAAACACAAATACGAAAAATTATA
GCCTATTCATCAATTGCCCACATAGGATGAATATTAGCAATTCTTCCTTA
CAACCCATCCCTCACTCTACTCAACCTCATAATCTATATTATTCTTACAG
CCCCTATATTCATAGCACTTATACTAAATAACTCTATAACCATCAACTCA
ATCTCACTTCTATGAAATAAAACTCCAGCAATACTAACTATAATCTCACT
GATATTACTATCCCTAGGAGGCCTTCCACCACTAACAGGATTCTTACCAA
AATGAATTATCATCACAGAACTTATAAAAAACAACTGTCTAATTATAGCA
ACACTCATAGCAATAATAGCTCTACTAAACCTATTCTTTTATACTCGCCT
AATTTATTCCACTTCACTAACAATATTTCCAACCAACAATAACTCAAAAA
TAATAACTCACCAAACAAAAACTAAACCCAACCTAATATTTTCCACCCTA
GCTATCATAAGCACAATAACCCTACCCCTAGCCCCCCAACTAATTACCTA
GAAGTTTAGGATATACTAGTCCGCGAGCCTTCAAAGCCCTAAGAAAACAC
ACAAGTTTAACTTCTGATAAGGACTGTAAGACTTCATCCTACATCTATTG
AATGCAAATCAATTGCTTTAATTAAGCTAAGACCTCAACTAGATTGGCAG
GAATTAAACCTACGAAAATTTAGTTAACAGCTAAATACCCTATTACTGGC
TTCAATCTACTTCTACCGCCGAAAAAAAAAAATGGCGGTAGAAGTCTTAG
TAGAGATTTCTCTACACCTTCGAATTTGCAATTCGACATGAATATCACCT
TAAGACCTCTGGTAAAAAGAGGATTTAAACCTCTGTGTTTAGATTTACAG
TCTAATGCTTACTCAGCCATTTTACCTATGTTCATTAATCGTTGATTATT
CTCAACCAATCACAAAGATATCGGAACCCTCTATCTACTATTCGGAGCCT
GAGCGGGAATAGTGGGTACTGCACTAAGTATTTTAATTCGAGCAGAATTA
GGTCAACCAGGTGCACTTTTAGGAGATGACCAAATTTACAATGTTATCGT
AACTGCCCATGCTTTTGTTATAATTTTCTTCATAGTAATACCAATAATAA
TTGGAGGCTTTGGAAACTGACTTGTCCCACTAATAATCGGAGCCCCAGAT
ATAGCATTCCCACGAATAAATAATATAAGTTTTTGACTCCTACCACCATC
ATTTCTCCTTCTCCTAGCATCATCAATAGTAGAAGCAGGAGCAGGAACAG
GATGAACAGTCTACCCACCTCTAGCCGGAAATCTAGCCCATGCAGGAGCA
TCAGTAGACCTAACAATTTTCTCCCTTCATTTAGCTGGAGTGTCATCTAT
TTTAGGTGCAATTAATTTTATTACCACTATTATCAACATGAAACCCCCAG
CCATAACACAGTATCAAACTCCACTATTTGTCTGATCCGTACTTATTACA
GCCGTACTGCTCCTATTATCACTACCAGTGCTAGCCGCAGGCATTACTAT
ACTACTAACAGACCGCAACCTAAACACAACTTTCTTTGATCCCGCTGGAG
GAGGGGACCCAATTCTCTACCAGCATCTGTTCTGATTCTTTGGGCACCCA
GAAGTTTATATTCTTATCCTCCCAGGATTTGGAATTATTTCACATGTAGT
TACTTACTACTCCGGAAAAAAAGAACCTTTCGGCTATATAGGAATAGTAT
GAGCAATAATGTCTATTGGCTTTCTAGGCTTTATTGTATGAGCCCACCAC
ATATTCACAGTAGGATTAGATGTAGACACACGAGCTTACTTTACATCAGC
CACTATAATTATCGCAATTCCTACCGGTGTCAAAGTATTTAGCTGACTTG
CAACCCTACACGGAGGTAATATTAAATGATCTCCAGCTATACTATGAGCC
TTAGGCTTTATTTTCTTATTTACAGTTGGTGGTCTAACCGGAATTGTTTT
ATCCAACTCATCCCTTGACATCGTGCTTCACGATACATACTATGTAGTAG
CCCATTTCCACTATGTTCTATCAATGGGAGCAGTGTTTGCTATCATAGCA
GGATTTGTTCACTGATTCCCATTATTTTCAGGCTTCACCCTAGATGACAC
ATGAGCAAAAGCCCACTTCGCCATCATATTCGTAGGAGTAAACATAACAT
TCTTCCCTCAACATTTCCTGGGCCTTTCAGGAATACCACGACGCTACTCA
GACTACCCAGATGCTTACACCACATGAAACACTGTCTCTTCTATAGGATC
ATTTATTTCACTAACAGCTGTTCTCATCATGATCTTTATAATTTGAGAGG
CCTTTGCTTCAAAACGAGAAGTAATATCAGTATCGTATGCTTCAACAAAT
TTAGAATGACTTCATGGCTGCCCTCCACCATATCACACATTCGAGGAACC
AACCTATGTAAAAGTAAAAtaagaaaggaaggaatcgaaccccctaaaat
tggtttcaagccaatctcatatcctatatgtctttctcAATAAGATATTA
GTAAAATCAATTACATAACTTTGTCAAAGTTAAATTATAGATCAATAATC
TATATATCTTATATGGCCTACCCATTCCAACTTGGTCTACAAGACGCCAC
ATCCCCTATTATAGAAGAGCTAATAAATTTCCATGATCACACACTAATAA
TTGTTTTCCTAATTAGCTCCTTAGTCCTCTATATCATCTCGCTAATATTA
ACAACAAAACTAACACATACAAGCACAATAGATGCACAAGAAGTTGAAAC
CATTTGAACTATTCTACCAGCTGTAATCCTTATCATAATTGCTCTCCCCT
CTCTACGCATTCTATATATAATAGACGAAATCAACAACCCCGTATTAACC
GTTAAAACCATAGGGCACCAATGATACTGAAGCTACGAATATACTGACTA
TGAAGACCTATGCTTTGATTCATATATAATCCCAACAAACGACCTAAAAC
CTGGTGAACTACGACTGCTAGAAGTTGATAACCGAGTCGTTCTGCCAATA
GAACTTCCAATCCGTATATTAATTTCATCTGAAGACGTCCTCCACTCATG
AGCAGTCCCCTCCCTAGGACTTAAAACTGATGCCATCCCAGGCCGACTAA
ATCAAGCAACAGTAACATCAAACCGACCAGGGTTATTCTATGGCCAATGC
TCTGAAATTTGTGGATCTAACCATAGCTTTATGCCCATTGTCCTAGAAAT
GGTTCCACTAAAATATTTCGAAAACTGATCTGCTTCAATAATTTAATTTC
ACTATGAAGCTAAGAGCGTTAACCTTTTAAGTTAAAGTTAGAGACCTTAA
AATCTCCATAGTGATATGCCACAACTAGATACATCAACATGATTTATCAC
AATTATCTCATCAATAATTACCCTATTTATCTTATTTCAACTAAAAGTCT
CATCACAAACATTCCCACTGGCACCTTCACCAAAATCACTAACAACCATA
AAAGTAAAAACCCCTTGAGAATTAAAATGAACGAAAATCTATTTGCCTCA
TTCATTACCCCAACAATAATAGGATTCCCAATCGTTGTAGCCATCATTAT
ATTTCCTTCAATCCTATTCCCATCCTCAAAACGCCTAATCAACAACCGTC
TCCATTCTTTCCAACACTGACTAGTTAAACTTATTATCAAACAAATAATG
CTAATCCACACACCAAAAGGACGAACATGAACCCTAATAATTGTTTCCCT
AATCATATTTATTGGATCAACAAATCTCCTAGGCCTTTTACCACATACAT
TTACACCTACTACCCAACTATCCATAAATCTAAGTATAGCCATTCCACTA
TGAGCTGGAGCCGTAATTACAGGCTTCCGACACAAACTAAAAAGCTCACT
TGCCCACTTCCTTCCACAAGGAACTCCAATTTCACTAATTCCAATACTTA
TTATTATTGAAACAATTAGCCTATTTATTCAACCAATGGCATTAGCAGTC
CGGCTTACAGCTAACATTACTGCAGGACACTTATTAATACACCTAATCGG
AGGAGCTACTCTAGTATTAATAAATATTAGCCCACCAACAGCTACCATTA
CATTTATTATTTTACTTCTACTCACAATTCTAGAATTTGCAGTAGCATTA
ATTCAAGCCTACGTATTCACCCTCCTAGTAAGCCTATATCTACATGATAA
TACATAATGACCCACCAAACTCATGCATATCACATAGTTAATCCAAGTCC
ATGACCATTAACTGGAGCCTTTTCAGCCCTCCTTCTAACATCAGGTCTAG
TAATATGATTTCACTATAATTCAATTACACTATTAACCCTTGGCCTACTC
ACCAATATCCTCACAATATATCAATGATGACGAGACGTAATTCGTGAAGG
AACCTACCAAGGCCACCACACTCCTATTGTACAAAAAGGACTACGATATG
GTATAATTCTATTCATCGTCTCGGAAGTATTTTTCTTTGCAGGATTCTTC
TGAGCGTTCTATCATTCTAGCCTCGTACCAACACATGATCTAGGAGGCTG
CTGACCTCCAACAGGAATTTCACCACTTAACCCTCTAGAAGTCCCACTAC
TTAATACTTCAGTACTTCTAGCATCAGGTGTTTCAATTACATGAGCTCAT
CATAGCCTTATAGAAGGTAAACGAAACCACATAAATCAAGCCCTACTAAT
TACCATTATACTAGGACTTTACTTCACCATCCTCCAAGCTTCAGAATACT
TTGAAACATCATTCTCCATTTCAGATGGTATCTATGGTTCTACATTCTTC
ATGGCTACTGGATTCCATGGACTCCATGTAATTATTGGATCAACATTCCT
TATTGTTTGCCTACTACGACAACTAAAATTTCACTTCACATCAAAACATC
ACTTCGGATTTGAAGCCGCAGCATGATACTGACATTTTGTAGACGTAGTC
TGACTTTTCCTATACGTCTCCATTTATTGATGAGGATCTTACTCCCTTAG
TATAATTAATATAACTGACTTCCAATTAGTAGATTCTGAATAAACCCAGA
AGAGAGTAATTAACCTGTACACTGTTATCTTCATTAATATTTTATTATCC
CTAACGCTAATTCTAGTTGCATTCTGACTCCCCCAAATAAATCTGTACTC
AGAAAAAGCAAATCCATATGAATGCGGATTCGACCCTACAAGCTCTGCAC
GTCTACCATTCTCAATAAAATTTTTCTTGGTAGCAATTACATTTCTATTA
TTTGACCTAGAAATTGCTCTTCTACTTCCACTACCATGAGCAATTCAAAC
AATTAAAACCTCTACTATAATAATTATAGCCTTTATTCTAGTCACAATTC
TATCTCTAGGCCTAGCATATGAATGAACACAAAAAGGATTAGAATGAACA
GAGTAAATGGTAATTAGTTTAAAAAAAATTAATGATTTCGACTCATTAGA
TTATGATGATGTTCATAATTACCAATATGCCATCTACCTTCTTCAACCTC
ACCATAGCCTTCTCACTATCACTTCTAGGGACACTTATATTTCGCTCTCA
CCTAATATCCACATTACTATGCCTGGAAGGCATAGTATTATCCTTATTTA
TTATAACTTCAGTAACTTCCCTAAACTCCAACTCCATAAGCTCCATACCA
ATCCCCATCACCATCTTAGTTTTCGCAGCCTGCGAAGCAGCTGTAGGACT
AGCCCTACTAGTAAAAGTTTCAAACACGTACGGAACAGATTACGTCCAAA
ATCTCAACCTACTACAATGCTAAAAATTATTCTTCCCTCACTAATGCTAC
TACCACTAACCTGACTATCAAGCCCTAAAAAAACCTGAACAAACGTAACC
TCATATAGTTTTCTAATTAGTTTAACCAGCCTAACACTTCTATGACAAAC
CGACGAAAATTATAAAAACTTTTCAAATATATTCTCCTCAGACCCCCTAT
CCACACCATTAATTATTTTAACAGCCTGATTACTGCCACTAATATTAATA
GCTAGCCAAAACCACCTAAAAAAAGATAATAACGTACTACAAAAACTCTA
CATCTCAATACTAATCAGCTTACAAATTCTCCTAATCATAACCTTTTCAG
CAACTGAACtaattatattttatattttatttGAAGCAACCTTAATCCCA
ACACTTATTATTATTACCCGATGAGGGAACCAAACTGAACGCCTAAACGC
AGGGATTTATTTCCTATTTTATACCCTAATCGGTTCTATTCCACTGCTAA
TTGCCCTCATCTTAATCCAAAACCATGTAGGAACCCTAAACCTCATAATT
TTATCATTCACAACACACACCTTAGACGCTTCATGATCTAACAACTTACT
ATGGTTGGCATGCATAATAGCATTTCTTATTAAAATACCATTATATGGAG
TTCACCTATGACTACCAAAAGCCCATGTTGAAGCTCCAATTGCTGGGTCA
ATAATTCTAGCAGCTATTCTTCTAAAATTAGGTAGTTACGGAATAATTCG
CATCTCCATTATTCTAGACCCACTAACAAAATATATAGCATACCCCTTCA
TCCTTCTCTCCCTATGAGGAATAATTATAACTAGCTCAATCTGCTTACGC
CAAACAGATTTAAAATCACTAATCGCCTACTCCTCAGTTAGCCACATAGC
ACTTGTTATTGCATCAATCATAATCCAAACTCCATGAAGCTTCATAGGAG
CAACAATACTAATAATCGCACATGGCCTCACATCATCACTCCTATTCTGC
CTAGCAAACTCCAACTACGAACGGATCCACAGCCGTACTATAATCATGGC
CCGAGGACTTCAAATGGTCTTCCCACTTATAGCCACATGATGACTGATAG
CAAGTCTAGCTAATCTAGCTCTACCCCCTTCAATCAATCTAATAGGAGAA
TTATTCATTACCATATCATTATTTTCTTGATCAAACTTTACCATTATTCT
TATAGGAATTAACATTATTATTACAGGTATATACTCAATATACATAATTA
TTACCACCCAACGCGGCAAACTAACCAACCATATAATTAACCTCCAACCC
TCACACACACGAGAACTAACACTAATAGCCCTTCACATAATTCCACTTAT
TCTTCTAACTACCAGTCCAAAACTAATTACAGGCCTGACAATATGTGAAT
ATAGTTTACAAAAAACATTAGACTGTGAATCTGACAACAGGAAATAAACC
TCCTTATTCACCAAGAAAGATTGCAAGAACTGCTAATTCATGCTTCCATG
TTTAAAAACATGGCTTTCTTACTTTTATAGGATAATAGTAATCCATTGGT
CTTAGGAACCAAAAACCTTGGTGCAAATCCAAATAAAAGTAATCAATATT
TTCACAACCTCAATCTTATTAATCTTCATTCTTCTACTATCCCCAATCCT
AATTTCAATATCAAACCTAATTAAACACATCAACTTCCCACTGTACACCA
CCACATCAATCAAATTCTCCTTCATTATTAGCCTCTTACCCCTATTAATA
TTTTTCCACAATAATATAGAATATATAATTACAACCTGGCACTGAGTCAC
CATAAATTCAATAGAACTTAAAATAAGCTTCAAAACTGACTTTTTCTCTA
TCCTGTTTACATCTGTAGCCCTTTTTGTCACATGATCAATTATACAATTC
TCTTCATGATATATACACTCAGACCCAAACATCAATCGATTCATTAAATA
TCTTACACTATTCCTGATTACCATGCTTATCCTCACCTCAGCCAACAACA
TATTTCAACTTTTCATTGGCTGAGAAGGGGTGGGAATTATATCTTTCCTA
CTAATTGGATGATGGTACGGACGAACAGACGCAAATACTGCAGCCCTACA
AGCAATCCTCTATAACCGCATCGGAGACATCGGATTCATTTTAGCTATAG
TTTGATTTTCCCTAAACATAAACTCATGAGAACTTCAACAGATTATATTC
TCCAACAACAACGACAATCTAATTCCACTTATAGGCCTATTAATCGCAGC
TACAGGAAAATCAGCACAATTTGGCCTCCACCCATGACTACCATCAGCAA
TAGAAGGCCCTACACCAGTTTCAGCACTACTACACTCAAGTACAATAGTA
GTTGCAGGAATTTTCCTACTGGTCCGATTCCACCCCCTCACGACTAATAA
TAACTTTATTTTAACAACTATACTTTGCCTCGGAGCCCTAACCACATTAT
TTACAGCTATTTGTGCTCTCACCCAAAACGACATCAAAAAAATCATTGCC
TTCTCTACATCAAGCCAACTAGGCCTGATAATAGTGACGCTAGGAATAAA
CCAACCACACCTAGCATTCCTACACATCTGTACCCACGCATTCTTCAAAG
CTATACTCTTTATATGCTCTGGCTCAATCATTCATAGCCTGGCAGACGAA
CAAGACATCCGAAAAATAGGAAACATCACAAAAATCATACCATTCACATC
ATCATGCCTAGTAATCGGAAGCCTCGCCCTCACAGGAATACCATTCCTAA
CAGGGTTCTACTCAAAAGACCTAATTATTGAAGCAATTAATACCTGCAAC
ACCAACGCCTGAGCCCTACTAATTACACTAATCGCCACTTCTATAACAGC
TATGTACAGCATACGAATCATTTACTTCGTAACAATAACAAAACCGCGTT
TTCCCCCCCTAATCTCCATTAACGAAAATGACCCAGACCTCATAAACCCA
ATCAAACGCCTAGCATTCGGAAGCATCTTTGCAGGATTTGTCATCTCATA
TAATATTCCACCAACCAGCATTCCAGTCCTCACAATACCATGATTTTTAA
AAACCACAGCCCTAATTATTTCAGTATTAGGATTCCTAATCGCACTAGAA
CTAAACAACCTAACCATAAAACTATCAATAAATAAAGCAAATCCATATTC
ATCCTTCTCAACTTTACTGGGGTTTTTCCCATCTATTATTCACCGCATTA
CACCCATAAAATCTCTCAACCTAAGCCTAAAAACATCCCTAACTCTCCTA
GACTTGATCTGGTTAGAAAAAACCATCCCAAAATCCACCTCAACTCTTCA
CACAAACATAACCACTTTAACAACCAACCAAAAAGGCTTAATTAAATTGT
ACTTTATATCATTCCTAATTAACATCATCTTAATTATTATCTTATACTCA
ATTAATCTCGAGTAATCTCGATAATAATAAAAATACCCGCAAACAAAGAT
CACCCAGCTACTACCATCATTCAAGTAGCACAACTATATATTGCCGCTAC
CCCAATCCCTCCTTCCAACATAACTCCAACATCATCAACCTCATACATCA
ACCAATCTCCCAAACCATCAAGATTAATTACTCCAACTTCATCATAATAA
TTAAGCACACAAATTAAAAAAACCTCTATAATCACCCCCAATACTAAAAA
ACCCAAAATTAATCAGTTAGATCCCCAAGTCTCTGGATATTCCTCAGTAG
CTATAGCAGTCGTATATCCAAACACAACCAACATCCCCCCTAAATAAATT
AAAAAAACTATTAAACCTAAAAACGATCCACCAAACCCTAAAACCATTAA
ACAACCAACAAACCCACTAACAATTAAACCTAAACCTCCATAAATAGGTG
AAGGCTTTAATGCTAACCCAAGACAACCAACCAAAAATAATGAACTTAAA
ACAAAAATATAATTATTCATTATTTCTACACAGCATTCAACTGCGACCAA
TGACATGAAAAATCATCGTTGTAATTCAACTACAGAAACACCTAATGACA
AACATACGAAAAACACACCCATTATTTAAAATTATTAACCACTCATTCAT
TGACCTACCTGCCCCATCCAACATTTCATCATGATGAAACTTTGGGTCCC
TTCTAGGAGTCTGCCTAATAGTCCAAATCATTACAGGTCTTTTCTTAGCC
ATACACTACACATCAGATACAATAACAGCCTTTTCATCAGTAACACACAT
TTGTCGAGACGTAAATTACGGGTGACTAATCCGATATATACACGCAAACG
GAGCCTCAATATTTTTTATTTGCTTATTCCTTCATGTCGGACGAGGCTTA
TATTATGGATCATATACATTTATAGAAACCTGAAACATTGGAGTACTTCT
ACTGTTCGCAGTCATAGCCACAGCATTTATAGGCTACGTCCTTCCATGAG
GACAAATATCATTCTGAGGTGCCACAGTTATTACAAACCTCCTATCAGCC
ATCCCATATATTGGAACAACCCTAGTCGAATGAATTTGAGGGGGCTTCTC
AGTAGACAAAGCCACCTTGACCCGATTCTTCGCTTTCCACTTCATCTTAC
CATTTATTATCGCGGCCCTAGCAATCGTTCACCTCCTCTTCCTCCACGAA
ACAGGATCAAACAACCCAACAGGATTAAACTCAGATGCAGATAAAATTCC
ATTTCACCCCTACTATACAATCAAAGATATCCTAGGTATCCTAATCATAT
TCTTAATTCTCATAACCCTAGTATTATTTTTCCCAGACATACTAGGAGAC
CCAGACAACTACATACCAGCTAATCCACTAAACACCCCACCCCATATTAA
ACCCGAATGATATTTCCTATTTGCATACGCCATTCTACGCTCAATCCCCA
ATAAACTAGGAGGTGTCCTAGCCTTAATCTTATCTATCCTAATTTTAGCC
CTAATACCTTTCCTTCATACCTCAAAGCAACGAAGCCTAATATTCCGCCC
AATCACACAAATTTTGTACTGAATCCTAGTAGCCAACCTACTTATCTTAA
CCTGAATTGGGGGCCAACCAGTAGAACACCCATTTATTATCATTGGCCAA
CTAGCCTCCATCTCATACTTCTCAATCATCTTAATTCTTATACCAATCTC
AGGAATTATCGAAGACAAAATACTAAAATTATATCCATGTCTTGATAGTA
TAAACATTACTCTGGTCTTGTAAACCTGAAATGAAGATCTTCTCTTCTCA
AGACATCAAGAAGAAGGAGCTACTCCCCACCACCAGCACCCAAAGCTGGT
ATTCTAATTAAACTACTTCTTGAGTACATAAATTTACATAGTACAACAGT
ACATTTATGTATATCGTACATTAAACTATTTTCCCCAAGCATATAAGCTA
GTACATTAAATCAATGGTTCAGGTCATAAAATAATCATCAACATAAATCA
ATATATATACCATGAATATTATCTTAAACACATTAAACTAATGTTATAAG
GACATATCTGTGTTATCTGACATACACCATACAGTCATAAACTCTTCTCT
TCCATATGACTATCCCCTTCCCCATTTGGTCTATTAATCTACCATCCTCC
GTGAAACCAACAACCCGCCCACCAATGCCCCTCTTCTCGCTCCGGGCCCA
TTAAACTTGGGGGTAGCTAAACTGAAACTTTATCAGACATCTGGTTCTTA
CTTCAGGGCCATCAAATGCGTTATCGCCCATACGTTCCCCTTAAATAAGA
CATCTCGATGGTATCGGGTCTAATCAGCCCATGACCAACATAACTGTGGT
GTCATGCATTTGGTATCTTTTTATTTTGGCCTACTTTCATCAACATAGCC
GTCAAGGCATGAAAGGACAGCACACAGTCTAGACGCACCTACGGTGAAGA
ATCATTAGTCCGCAAAACCCAATCACCTAAGGCTAATTATTCATGCTTGT
TAGACATAAATGCTACTCAATACCAAATTTTAACTCTCCAAACCCCCCAC
CCCCTCCTCTTAATGCCAAACCCCAAAAACACTAAGAACTTGAAAGACAT
ATAATATTAACTATCAAACCCTATGTCCTGATCAATTCTAGTAGTTCCCA
AAATATGACTTATATTTTAGTACTTGTAAAAATTTTACAAAATCATGTTC
CGTGAACCAAAACTCTAATCATACTCTATTACGCAATAAACATTAACAA
chrM Mt_tRNA exon 1 68 . + . gene_id "ENSMUSG00000064336"; transcript_id "ENSMUST00000082387"; exon_number "1"; gene_name "mt-Tf"; transcript_name "mt-Tf-201";
chrM Mt_rRNA exon 70 1024 . + . gene_id "ENSMUSG00000064337"; transcript_id "ENSMUST00000082388"; exon_number "1"; gene_name "mt-Rnr1"; transcript_name "mt-Rnr1-201";
chrM Mt_tRNA exon 1025 1093 . + . gene_id "ENSMUSG00000064338"; transcript_id "ENSMUST00000082389"; exon_number "1"; gene_name "mt-Tv"; transcript_name "mt-Tv-201";
chrM Mt_rRNA exon 1094 2675 . + . gene_id "ENSMUSG00000064339"; transcript_id "ENSMUST00000082390"; exon_number "1"; gene_name "mt-Rnr2"; transcript_name "mt-Rnr2-201";
chrM Mt_tRNA exon 2676 2750 . + . gene_id "ENSMUSG00000064340"; transcript_id "ENSMUST00000082391"; exon_number "1"; gene_name "mt-Tl1"; transcript_name "mt-Tl1-201";
chrM protein_coding exon 2751 3707 . + . gene_id "ENSMUSG00000064341"; transcript_id "ENSMUST00000082392"; exon_number "1"; gene_name "mt-Nd1"; transcript_name "mt-Nd1-201";
chrM protein_coding CDS 2751 3704 . + 0 gene_id "ENSMUSG00000064341"; transcript_id "ENSMUST00000082392"; exon_number "1"; gene_name "mt-Nd1"; transcript_name "mt-Nd1-201"; protein_id "ENSMUSP00000080991";
chrM protein_coding stop_codon 3705 3707 . + 0 gene_id "ENSMUSG00000064341"; transcript_id "ENSMUST00000082392"; exon_number "1"; gene_name "mt-Nd1"; transcript_name "mt-Nd1-201";
chrM Mt_tRNA exon 3706 3774 . + . gene_id "ENSMUSG00000064342"; transcript_id "ENSMUST00000082393"; exon_number "1"; gene_name "mt-Ti"; transcript_name "mt-Ti-201";
chrM Mt_tRNA exon 3772 3842 . - . gene_id "ENSMUSG00000064343"; transcript_id "ENSMUST00000082394"; exon_number "1"; gene_name "mt-Tq"; transcript_name "mt-Tq-201";
chrM Mt_tRNA exon 3845 3913 . + . gene_id "ENSMUSG00000064344"; transcript_id "ENSMUST00000082395"; exon_number "1"; gene_name "mt-Tm"; transcript_name "mt-Tm-201";
chrM protein_coding exon 3914 4951 . + . gene_id "ENSMUSG00000064345"; transcript_id "ENSMUST00000082396"; exon_number "1"; gene_name "mt-Nd2"; transcript_name "mt-Nd2-201";
chrM protein_coding CDS 3914 4948 . + 0 gene_id "ENSMUSG00000064345"; transcript_id "ENSMUST00000082396"; exon_number "1"; gene_name "mt-Nd2"; transcript_name "mt-Nd2-201"; protein_id "ENSMUSP00000080992";
chrM protein_coding stop_codon 4949 4951 . + 0 gene_id "ENSMUSG00000064345"; transcript_id "ENSMUST00000082396"; exon_number "1"; gene_name "mt-Nd2"; transcript_name "mt-Nd2-201";
chrM Mt_tRNA exon 4950 5016 . + . gene_id "ENSMUSG00000064346"; transcript_id "ENSMUST00000082397"; exon_number "1"; gene_name "mt-Tw"; transcript_name "mt-Tw-201";
chrM Mt_tRNA exon 5018 5086 . - . gene_id "ENSMUSG00000064347"; transcript_id "ENSMUST00000082398"; exon_number "1"; gene_name "mt-Ta"; transcript_name "mt-Ta-201";
chrM Mt_tRNA exon 5089 5159 . - . gene_id "ENSMUSG00000064348"; transcript_id "ENSMUST00000082399"; exon_number "1"; gene_name "mt-Tn"; transcript_name "mt-Tn-201";
chrM Mt_tRNA exon 5192 5257 . - . gene_id "ENSMUSG00000064349"; transcript_id "ENSMUST00000082400"; exon_number "1"; gene_name "mt-Tc"; transcript_name "mt-Tc-201";
chrM Mt_tRNA exon 5260 5326 . - . gene_id "ENSMUSG00000064350"; transcript_id "ENSMUST00000082401"; exon_number "1"; gene_name "mt-Ty"; transcript_name "mt-Ty-201";
chrM protein_coding exon 5328 6872 . + . gene_id "ENSMUSG00000064351"; transcript_id "ENSMUST00000082402"; exon_number "1"; gene_name "mt-Co1"; transcript_name "mt-Co1-201";
chrM protein_coding CDS 5328 6869 . + 0 gene_id "ENSMUSG00000064351"; transcript_id "ENSMUST00000082402"; exon_number "1"; gene_name "mt-Co1"; transcript_name "mt-Co1-201"; protein_id "ENSMUSP00000080993";
chrM protein_coding start_codon 5328 5330 . + 0 gene_id "ENSMUSG00000064351"; transcript_id "ENSMUST00000082402"; exon_number "1"; gene_name "mt-Co1"; transcript_name "mt-Co1-201";
chrM protein_coding stop_codon 6870 6872 . + 0 gene_id "ENSMUSG00000064351"; transcript_id "ENSMUST00000082402"; exon_number "1"; gene_name "mt-Co1"; transcript_name "mt-Co1-201";
chrM Mt_tRNA exon 6870 6938 . - . gene_id "ENSMUSG00000064352"; transcript_id "ENSMUST00000082403"; exon_number "1"; gene_name "mt-Ts1"; transcript_name "mt-Ts1-201";
chrM Mt_tRNA exon 6942 7011 . + . gene_id "ENSMUSG00000064353"; transcript_id "ENSMUST00000082404"; exon_number "1"; gene_name "mt-Td"; transcript_name "mt-Td-201";
chrM protein_coding exon 7013 7696 . + . gene_id "ENSMUSG00000064354"; transcript_id "ENSMUST00000082405"; exon_number "1"; gene_name "mt-Co2"; transcript_name "mt-Co2-201";
chrM protein_coding CDS 7013 7693 . + 0 gene_id "ENSMUSG00000064354"; transcript_id "ENSMUST00000082405"; exon_number "1"; gene_name "mt-Co2"; transcript_name "mt-Co2-201"; protein_id "ENSMUSP00000080994";
chrM protein_coding start_codon 7013 7015 . + 0 gene_id "ENSMUSG00000064354"; transcript_id "ENSMUST00000082405"; exon_number "1"; gene_name "mt-Co2"; transcript_name "mt-Co2-201";
chrM protein_coding stop_codon 7694 7696 . + 0 gene_id "ENSMUSG00000064354"; transcript_id "ENSMUST00000082405"; exon_number "1"; gene_name "mt-Co2"; transcript_name "mt-Co2-201";
chrM Mt_tRNA exon 7700 7764 . + . gene_id "ENSMUSG00000064355"; transcript_id "ENSMUST00000082406"; exon_number "1"; gene_name "mt-Tk"; transcript_name "mt-Tk-201";
chrM protein_coding exon 7766 7969 . + . gene_id "ENSMUSG00000064356"; transcript_id "ENSMUST00000082407"; exon_number "1"; gene_name "mt-Atp8"; transcript_name "mt-Atp8-201";
chrM protein_coding CDS 7766 7966 . + 0 gene_id "ENSMUSG00000064356"; transcript_id "ENSMUST00000082407"; exon_number "1"; gene_name "mt-Atp8"; transcript_name "mt-Atp8-201"; protein_id "ENSMUSP00000080995";
chrM protein_coding start_codon 7766 7768 . + 0 gene_id "ENSMUSG00000064356"; transcript_id "ENSMUST00000082407"; exon_number "1"; gene_name "mt-Atp8"; transcript_name "mt-Atp8-201";
chrM protein_coding stop_codon 7967 7969 . + 0 gene_id "ENSMUSG00000064356"; transcript_id "ENSMUST00000082407"; exon_number "1"; gene_name "mt-Atp8"; transcript_name "mt-Atp8-201";
chrM protein_coding exon 7927 8607 . + . gene_id "ENSMUSG00000064357"; transcript_id "ENSMUST00000082408"; exon_number "1"; gene_name "mt-Atp6"; transcript_name "mt-Atp6-201";
chrM protein_coding CDS 7927 8604 . + 0 gene_id "ENSMUSG00000064357"; transcript_id "ENSMUST00000082408"; exon_number "1"; gene_name "mt-Atp6"; transcript_name "mt-Atp6-201"; protein_id "ENSMUSP00000080996";
chrM protein_coding start_codon 7927 7929 . + 0 gene_id "ENSMUSG00000064357"; transcript_id "ENSMUST00000082408"; exon_number "1"; gene_name "mt-Atp6"; transcript_name "mt-Atp6-201";
chrM protein_coding stop_codon 8605 8607 . + 0 gene_id "ENSMUSG00000064357"; transcript_id "ENSMUST00000082408"; exon_number "1"; gene_name "mt-Atp6"; transcript_name "mt-Atp6-201";
chrM protein_coding exon 8607 9390 . + . gene_id "ENSMUSG00000064358"; transcript_id "ENSMUST00000082409"; exon_number "1"; gene_name "mt-Co3"; transcript_name "mt-Co3-201";
chrM protein_coding CDS 8607 9390 . + 0 gene_id "ENSMUSG00000064358"; transcript_id "ENSMUST00000082409"; exon_number "1"; gene_name "mt-Co3"; transcript_name "mt-Co3-201"; protein_id "ENSMUSP00000080997";
chrM protein_coding start_codon 8607 8609 . + 0 gene_id "ENSMUSG00000064358"; transcript_id "ENSMUST00000082409"; exon_number "1"; gene_name "mt-Co3"; transcript_name "mt-Co3-201";
chrM Mt_tRNA exon 9391 9458 . + . gene_id "ENSMUSG00000064359"; transcript_id "ENSMUST00000082410"; exon_number "1"; gene_name "mt-Tg"; transcript_name "mt-Tg-201";
chrM protein_coding exon 9459 9806 . + . gene_id "ENSMUSG00000064360"; transcript_id "ENSMUST00000082411"; exon_number "1"; gene_name "mt-Nd3"; transcript_name "mt-Nd3-201";
chrM protein_coding CDS 9459 9803 . + 0 gene_id "ENSMUSG00000064360"; transcript_id "ENSMUST00000082411"; exon_number "1"; gene_name "mt-Nd3"; transcript_name "mt-Nd3-201"; protein_id "ENSMUSP00000080998";
chrM protein_coding stop_codon 9804 9806 . + 0 gene_id "ENSMUSG00000064360"; transcript_id "ENSMUST00000082411"; exon_number "1"; gene_name "mt-Nd3"; transcript_name "mt-Nd3-201";
chrM Mt_tRNA exon 9808 9875 . + . gene_id "ENSMUSG00000064361"; transcript_id "ENSMUST00000082412"; exon_number "1"; gene_name "mt-Tr"; transcript_name "mt-Tr-201";
chrM protein_coding exon 9877 10173 . + . gene_id "ENSMUSG00000065947"; transcript_id "ENSMUST00000084013"; exon_number "1"; gene_name "mt-Nd4l"; transcript_name "mt-Nd4l-201";
chrM protein_coding CDS 9877 10170 . + 0 gene_id "ENSMUSG00000065947"; transcript_id "ENSMUST00000084013"; exon_number "1"; gene_name "mt-Nd4l"; transcript_name "mt-Nd4l-201"; protein_id "ENSMUSP00000081021";
chrM protein_coding start_codon 9877 9879 . + 0 gene_id "ENSMUSG00000065947"; transcript_id "ENSMUST00000084013"; exon_number "1"; gene_name "mt-Nd4l"; transcript_name "mt-Nd4l-201";
chrM protein_coding stop_codon 10171 10173 . + 0 gene_id "ENSMUSG00000065947"; transcript_id "ENSMUST00000084013"; exon_number "1"; gene_name "mt-Nd4l"; transcript_name "mt-Nd4l-201";
chrM protein_coding exon 10167 11544 . + . gene_id "ENSMUSG00000064363"; transcript_id "ENSMUST00000082414"; exon_number "1"; gene_name "mt-Nd4"; transcript_name "mt-Nd4-201";
chrM protein_coding CDS 10167 11544 . + 0 gene_id "ENSMUSG00000064363"; transcript_id "ENSMUST00000082414"; exon_number "1"; gene_name "mt-Nd4"; transcript_name "mt-Nd4-201"; protein_id "ENSMUSP00000081000";
chrM protein_coding start_codon 10167 10169 . + 0 gene_id "ENSMUSG00000064363"; transcript_id "ENSMUST00000082414"; exon_number "1"; gene_name "mt-Nd4"; transcript_name "mt-Nd4-201";
chrM Mt_tRNA exon 11546 11612 . + . gene_id "ENSMUSG00000064364"; transcript_id "ENSMUST00000082415"; exon_number "1"; gene_name "mt-Th"; transcript_name "mt-Th-201";
chrM Mt_tRNA exon 11613 11671 . + . gene_id "ENSMUSG00000064365"; transcript_id "ENSMUST00000082416"; exon_number "1"; gene_name "mt-Ts2"; transcript_name "mt-Ts2-201";
chrM Mt_tRNA exon 11671 11741 . + . gene_id "ENSMUSG00000064366"; transcript_id "ENSMUST00000082417"; exon_number "1"; gene_name "mt-Tl2"; transcript_name "mt-Tl2-201";
chrM protein_coding exon 11742 13565 . + . gene_id "ENSMUSG00000064367"; transcript_id "ENSMUST00000082418"; exon_number "1"; gene_name "mt-Nd5"; transcript_name "mt-Nd5-201";
chrM protein_coding CDS 11742 13562 . + 0 gene_id "ENSMUSG00000064367"; transcript_id "ENSMUST00000082418"; exon_number "1"; gene_name "mt-Nd5"; transcript_name "mt-Nd5-201"; protein_id "ENSMUSP00000081001";
chrM protein_coding stop_codon 13563 13565 . + 0 gene_id "ENSMUSG00000064367"; transcript_id "ENSMUST00000082418"; exon_number "1"; gene_name "mt-Nd5"; transcript_name "mt-Nd5-201";
chrM protein_coding exon 13552 14070 . - . gene_id "ENSMUSG00000064368"; transcript_id "ENSMUST00000082419"; exon_number "1"; gene_name "mt-Nd6"; transcript_name "mt-Nd6-201";
chrM protein_coding CDS 13555 14070 . - 0 gene_id "ENSMUSG00000064368"; transcript_id "ENSMUST00000082419"; exon_number "1"; gene_name "mt-Nd6"; transcript_name "mt-Nd6-201"; protein_id "ENSMUSP00000081002";
chrM protein_coding start_codon 14068 14070 . - 0 gene_id "ENSMUSG00000064368"; transcript_id "ENSMUST00000082419"; exon_number "1"; gene_name "mt-Nd6"; transcript_name "mt-Nd6-201";
chrM protein_coding stop_codon 13552 13554 . - 0 gene_id "ENSMUSG00000064368"; transcript_id "ENSMUST00000082419"; exon_number "1"; gene_name "mt-Nd6"; transcript_name "mt-Nd6-201";
chrM Mt_tRNA exon 14071 14139 . - . gene_id "ENSMUSG00000064369"; transcript_id "ENSMUST00000082420"; exon_number "1"; gene_name "mt-Te"; transcript_name "mt-Te-201";
chrM protein_coding exon 14145 15288 . + . gene_id "ENSMUSG00000064370"; transcript_id "ENSMUST00000082421"; exon_number "1"; gene_name "mt-Cytb"; transcript_name "mt-Cytb-201";
chrM protein_coding CDS 14145 15288 . + 0 gene_id "ENSMUSG00000064370"; transcript_id "ENSMUST00000082421"; exon_number "1"; gene_name "mt-Cytb"; transcript_name "mt-Cytb-201"; protein_id "ENSMUSP00000081003";
chrM protein_coding start_codon 14145 14147 . + 0 gene_id "ENSMUSG00000064370"; transcript_id "ENSMUST00000082421"; exon_number "1"; gene_name "mt-Cytb"; transcript_name "mt-Cytb-201";
chrM Mt_tRNA exon 15289 15355 . + . gene_id "ENSMUSG00000064371"; transcript_id "ENSMUST00000082422"; exon_number "1"; gene_name "mt-Tt"; transcript_name "mt-Tt-201";
chrM Mt_tRNA exon 15356 15422 . - . gene_id "ENSMUSG00000064372"; transcript_id "ENSMUST00000082423"; exon_number "1"; gene_name "mt-Tp"; transcript_name "mt-Tp-201";
chrM miRNA exon 16115 16209 . - . gene_id "ENSMUSG00000076442"; transcript_id "ENSMUST00000103243"; exon_number "1"; gene_name "mmu-mir-805"; transcript_name "mmu-mir-805.1-201";
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment