Created
June 11, 2015 04:17
-
-
Save shahril96/205c1caa76bf531ad8dd to your computer and use it in GitHub Desktop.
POC of Longest Common Sub-Sequence problem with complexity O(nm)
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
/* References : | |
http://www.geeksforgeeks.org/dynamic-programming-set-4-longest-common-subsequence/ | |
https://www.ics.uci.edu/~eppstein/161/960229.html */ | |
#include <stdio.h> | |
#include <string.h> | |
#define MAX(X,Y) ((X) > (Y)) ? (X) : (Y) | |
char str[100]; | |
int lcs(char *X, char *Y, int m, int n) | |
{ | |
int i, j, table[50][50]; | |
char *ptr = str; | |
for(i = m; i >= 0; i--) | |
for(j = n; j >= 0; j--) | |
{ | |
if(X[i] == 0 || Y[j] == 0) | |
table[i][j] = 0; | |
else if(X[i] == Y[j]) | |
table[i][j] = 1 + table[i+1][j+1]; | |
else | |
table[i][j] = MAX(table[i+1][j], table[i][j+1]); | |
} | |
i = j = 0; | |
while(i < m && j < n) | |
{ | |
if(X[i] == Y[j]) | |
{ | |
*ptr++ = X[i]; | |
i++, j++; | |
} | |
else if(table[i+1][j] >= table[i][j+1]) i++; | |
else j++; | |
} | |
return table[0][0]; | |
} | |
int main() | |
{ | |
char X[] = "ACCGGGTTACCGTTTAAAACCCGGGTAACCT"; | |
char Y[] = "CCAGGACCAGGGACCGTTTACCAGCCTTAAACCA"; | |
printf("lcs -> %d\nlcs itself -> %s\n", lcs(X, Y, sizeof X - 1, sizeof Y - 1), str); | |
} |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment