Genome browser for phamerator.org
forked from scresawn's block: genome browser
Last active
March 3, 2016 15:26
-
-
Save smith13mr/4742802e9cf761912270 to your computer and use it in GitHub Desktop.
genome browser 2 with numbers
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| [{ | |
| "name": 1, | |
| "sequence": "ATGCTACGTAGCTACGTACGATCGTACGATCGATCGTACG", | |
| "start": 50, | |
| "stop": 2000, | |
| "direction": "forward" | |
| }, | |
| { | |
| "name": 2, | |
| "sequence": "GACTGACTGACTAGCTGACTGATCGTACTCGAT", | |
| "start": 2150, | |
| "stop": 2900, | |
| "direction": "forward" | |
| }, | |
| { | |
| "name": 3, | |
| "sequence": "ATCGTACGTACGTACGTACGATCGTACGATCGCGCGCGCGGCGCATCGATCGATCGTACTA", | |
| "start": 3000, | |
| "stop": 4550, | |
| "direction": "reverse" | |
| }, | |
| { | |
| "name": 4, | |
| "sequence": "TTCTAGTCGATCGTACGTGTACGTGCATTATTGATGCTATATATCGTATATACGTA", | |
| "start": 4700, | |
| "stop": 7550, | |
| "direction": "reverse" | |
| } | |
| ] |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
| <!DOCTYPE html> | |
| <head> | |
| <meta charset="utf-8"> | |
| <script src="https://cdnjs.cloudflare.com/ajax/libs/d3/3.5.5/d3.min.js"></script> | |
| </head> | |
| <body> | |
| <script> | |
| var genomelength = 9000; | |
| var tickMarks = {thousand: [], fivehundred: [], onehundred: []}; | |
| var genome_positions = []; | |
| for (var i = 1; i <= genomelength; i++) { | |
| genome_positions.push(i); | |
| } | |
| genome_positions.forEach(function(currentValue, index, myArray){ | |
| if (currentValue % 1000 === 0) { | |
| tickMarks.thousand.push(currentValue); | |
| } | |
| else if (currentValue % 500 === 0) { | |
| tickMarks.fivehundred.push(currentValue); | |
| } | |
| else if (currentValue % 100 === 0) { | |
| tickMarks.onehundred.push(currentValue); | |
| } | |
| }); | |
| var svg = d3.select("body").append("svg").attr({height: 500,width: genomelength/10}); | |
| svg.append("rect") | |
| .attr({x: 0, y: 100, width: genomelength/10, height: 30}) | |
| .style({"stroke-width": "2px", "fill": "white", "stroke": "black"}); | |
| d3.json("genes.json.txt", function(error, json) { | |
| if (error) return console.warn(error); | |
| var genes = svg.selectAll(".genes") | |
| .data(json) | |
| .enter() | |
| .append ("g"); | |
| genes.append("rect") | |
| .attr("x", function (d) { return d.start/10; }) | |
| .attr("y", function (d) { return 100; }) | |
| .attr("height", function(d) { return 0;}) | |
| .attr("width", function (d) { return (d.stop-d.start)/10; }) | |
| .attr("style", function (d) { return (d.dirction)}) | |
| .style ("fill", function (d) { | |
| if (d.direction === "forward") { | |
| return "cyan"; | |
| } | |
| else if (d.direction === "reverse") { | |
| return "pink"; | |
| } | |
| else { | |
| return "black"; | |
| } | |
| }) | |
| .attr("y", function (d) { | |
| if (d.direction === "forward") { | |
| if (d.name%2 === 0) | |
| return 70; | |
| else { | |
| return 40; | |
| } | |
| } | |
| else { | |
| if (d.name%2 === 0) | |
| return 130; | |
| else { | |
| return 170; | |
| } | |
| } | |
| }) | |
| .attr("x", function (d) { | |
| if (d.direction === "forward") { | |
| return (0 - ((d.stop-d.start)/10)) - 2; | |
| } | |
| else if (d.direction === "reverse") { | |
| return (genomelength/10) + 2; | |
| } | |
| }) | |
| .style ({"stroke-width": "2px", "stroke": "black"}) | |
| .transition().delay(3000).duration(1000) | |
| .attr("height", function (d) { | |
| return 30; | |
| }) | |
| .attr("x", function (d) { | |
| return d.start/10; | |
| }); | |
| genes.append("text") // gene name | |
| .attr("x", function (d) { | |
| return ((d.stop+d.start)/2)/10; | |
| }) | |
| .attr("y", function (d) { | |
| if (d.direction === "forward") { | |
| if (d.name%2 === 0) | |
| return 90; | |
| else { | |
| return 60; | |
| } | |
| } | |
| else { | |
| if (d.name%2 === 0) | |
| return 150; | |
| else { | |
| return 190; | |
| } | |
| } | |
| }) | |
| .transition().delay(4000).duration(1000) | |
| .text ( function (d) { return d.name; }) | |
| .style({"text-anchor": "middle", "font-family": "ariel", "font-weight": "bold"}) | |
| .style ("fill", function(d) { | |
| if (d.direction === "forward") { | |
| return "black"; | |
| } | |
| else { | |
| return "black"; | |
| } | |
| }); | |
| var group = svg.selectAll(".a") | |
| .data(tickMarks.thousand) | |
| .enter() | |
| .append("g"); | |
| group.append("rect") | |
| .style({"fill": "black"}) | |
| .attr({x: 0, y: 100, width: "1px", height: 30}) | |
| .transition().duration(3000) | |
| .attr("transform", function (d) { return "translate(" + d/10 + ",0)"; }); | |
| var group2 = svg.selectAll(".b") | |
| .data(tickMarks.fivehundred) | |
| .enter() | |
| .append("g"); | |
| group2.append("rect") | |
| .style({"fill": "black"}) | |
| .attr({x: 0, y: 100, width: "1px", height: 15}) | |
| .transition().duration(2000) | |
| .attr("transform", function (d) { return "translate(" + d/10 + ",0)"; }); | |
| var group3 = svg.selectAll(".c") | |
| .data(tickMarks.onehundred) | |
| .enter() | |
| .append("g"); | |
| group3.append("rect") | |
| .style({"fill": "black"}) | |
| .attr({x: 0, y: 115, width: "1px", height: 15}) | |
| .transition().duration(1000) | |
| .attr("transform", function (d) { return "translate(" + d/10 + ",0)"; }) | |
| group.append("text") | |
| .text(function (d,i) { | |
| return i+1; | |
| }) | |
| .attr({y: 115, width: "1px", height: 15}) | |
| .attr("x", function(d) {return (d/10)+2;}) | |
| .attr({"font-size": "10px", "fill":"grey"}); | |
| }); | |
| </script> | |
| </body> |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment