This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python | |
from __future__ import print_function | |
import khmer | |
import sys | |
# Usage: $scriptname <infile> <numbands> | |
infile = sys.argv[1] | |
numbands = int(sys.argv[2]) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<!DOCTYPE HTML PUBLIC "-//W3C//DTD HTML 4.01//EN" "http://www.w3.org/TR/html4/strict.dtd"> | |
<html lang="en"> | |
<head> | |
<title>PSPT: Precision Solar Photometric Telescope</title> | |
<meta http-equiv="Content-Type" content="text/html; charset=ISO-8859-1"> | |
<link rel="stylesheet" type="text/css" href="css/custom-theme/jquery-ui-1.7.3.custom.css"> | |
<link rel="stylesheet" type="text/css" href="css/pspt.css"> | |
<script type="text/javascript" src="js/jquery-1.3.2.min.js"></script> |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env bash | |
curl http://lasp.colorado.edu/lisird/nrlssi/ > e7f9b45a-8fbe-441e-a9a6-5cb74a2591c3.html | |
curl http://lasp.colorado.edu/lisird/tss/nrlssi.csv? > nrlssi.csv |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
<!DOCTYPE html> | |
<html lang="en-us"> | |
<head> | |
<meta http-equiv="Content-Type" content="text/html; charset=UTF-8" /> | |
<title>LISIRD - Flare Irradiance Spectral Model (FISM)</title> | |
<link rel="stylesheet" type="text/css" href="/lisird/CSS/fism.css" /> | |
<script type="text/javascript" src="/lisird/scripts/js/fism.js"></script> | |
</head> |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python | |
from __future__ import print_function | |
import re | |
import khmer | |
import screed | |
import sys | |
infile = sys.argv[1] | |
bands = int(sys.argv[2]) |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python | |
from __future__ import print_function | |
import khmer | |
cg = khmer.Countgraph(31, 2e6, 4) | |
cg.consume_fasta('testing.fq.gz') | |
fpr = khmer.calc_expected_collisions(cg) | |
print('eFPR {:1.3f}'.format(fpr)) | |
kmer1 = 'TTACCATGACCAGTTTCTATGGTCATCCCAA' |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
>read0r start=10476,mutations=0 | |
GATTTGCGTTAGCAGACCGAACGGTGATATCCTGATACGAGCTGGACTTT | |
>read1f start=409,mutations=0 | |
TCGTTGCGCGTGAGCGCTGAGGTTCCAGTCTTTCCCTACGGCGTAGATGA | |
>read2r start=4012,mutations=0 | |
TTTGATGCGCGCTTGGTTCTTGTCTGCCGCCCAGCGCAGCCAAGCCGGTG | |
>read3r start=2286,mutations=0 | |
CATAAAGCATGCGGGGACCACCTGCATTTGGCCGCCTCGTAGTTCATTCT | |
>read4r start=11087,mutations=0 | |
CTGCGCTTGCAATGTAACATACGTTACGCAAAGCATAAGTGACCGGTCAA |
Sorry, something went wrong. Reload?
Sorry, we cannot display this file.
Sorry, this file is invalid so it cannot be displayed.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
#!/usr/bin/env python | |
import glob | |
import taglib | |
for filename in sorted(glob.glob('*.mp3')): | |
mp3 = taglib.File(filename) | |
mp3.tags['ALBUM'] = [filename] | |
_ = mp3.save() |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
import khmer | |
k = 31 | |
tablesize = 1e9 # 1GB | |
ntables = 4 | |
counts = khmer.Countgraph(k, tablesize, ntable) # 4GB total | |
counts.consume_fasta('NA19240.not-boring.fq.gz') # handles FASTA and FASTQ | |
bogus_kmer = 'A' * k # 31 As |