repeat_master
(a nameplay on RepeatMasker,
never thought anyone else excpet me would use it so sorry about the name,
feel free to rename it...) is a simple wrapper for querying the mice database with repeat master.
from repeat_master import repeat_master
repeat_master(list of sequences) # returns a list of results for each sequence, corresponding to the highest score entry from repeatmasker
For example:
repeat_master(['AAAATACCTTGGCATGACTCTAACTAAGGAAGTGAAAGATCTGTA'])
# => [[25, 2.2, 0.0, 0.0, 0, 1, 45, '(0)', '+', 'L1MdF_III', 'LINE/L1', '4378', '4422', '(2154)', 1]]