Last active
July 22, 2016 11:53
-
-
Save wwood/99cac38dd932c4f424400f151a9d693a to your computer and use it in GitHub Desktop.
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
starting phase `check' | |
t/00_requires_external.t | |
1..8 | |
ok 1 - blastp in PATH | |
ok 2 - makeblastdb in PATH | |
ok 3 - mcl in PATH | |
ok 4 - mcxdeblast in PATH | |
ok 5 - bedtools in PATH | |
ok 6 - prank in PATH | |
ok 7 - parallel in PATH | |
ok 8 - mafft in PATH | |
t/Bio/Roary/AccessoryBinaryFasta.t | |
ok 1 - use Bio::Roary::AccessoryBinaryFasta; | |
ok 2 - initialise accessory binary fasta file | |
ok 3 - create output file | |
ok 4 - binary accessory fasta file created | |
ok 5 - initialise accessory binary fasta file bounded | |
ok 6 - lower bound value | |
ok 7 - upper bound value | |
ok 8 - create output file bounded | |
ok 9 - binary accessory fasta file created bounded | |
1..9 | |
t/Bio/Roary/AccessoryClustering.t | |
ok 1 - use Bio::Roary::AccessoryClustering; | |
ok 2 - initialise object with identity of 1 | |
ok 3 - build the clusters for 1 | |
ok 4 - build samples weights for 1 | |
ok 5 - build samples to clusters for 1 | |
ok 6 - check number of clusters as expected, allowing for some variation for 1 | |
ok 7 - initialise object with identity of 0.90 | |
ok 8 - build the clusters for 0.90 | |
ok 9 - build samples weights for 0.90 | |
ok 10 - build samples to clusters for 0.90 | |
ok 11 - check number of clusters as expected, allowing for some variation for 0.90 | |
ok 12 - initialise object with identity of 0.95 | |
ok 13 - build the clusters for 0.95 | |
ok 14 - build samples weights for 0.95 | |
ok 15 - build samples to clusters for 0.95 | |
ok 16 - check number of clusters as expected, allowing for some variation for 0.95 | |
ok 17 - initialise object with identity of 0.99 | |
ok 18 - build the clusters for 0.99 | |
ok 19 - build samples weights for 0.99 | |
ok 20 - build samples to clusters for 0.99 | |
ok 21 - check number of clusters as expected, allowing for some variation for 0.99 | |
ok 22 - samples to clusters | |
ok 23 - sample weights | |
ok 24 - samples to clusters | |
ok 25 - sample weights | |
ok 26 - build the clusters for large_accessory_binary_genes.fa | |
ok 27 - build samples weights for large_accessory_binary_genes.fa | |
ok 28 - build samples to clusters for large_accessory_binary_genes.fa | |
ok 29 - check number of clusters as expected, allowing for some variation for large_accessory_binary_genes.fa | |
1..29 | |
t/Bio/Roary/AnalyseGroups.t | |
ok 1 - use Bio::Roary::AnalyseGroups; | |
ok 2 - initialise with two fasta files | |
ok 3 - Number of isolates | |
ok 4 - genes map to the correct files | |
ok 5 - Groups to genes hash | |
ok 6 - genes to groups hash | |
1..6 | |
t/Bio/Roary/AnnotateGroups.t | |
ok 1 - use Bio::Roary::AnnotateGroups; | |
ok 2 - initalise | |
ok 3 - reannotate | |
ok 4 - gene lengths as expected | |
ok 5 - group lengths | |
ok 6 - groups reannotated as expected | |
1..6 | |
t/Bio/Roary/AssemblyStatistics.t | |
ok 1 - use Bio::Roary::AssemblyStatistics; | |
ok 2 - initialise spreadsheet | |
ok 3 - all gene rows available | |
ok 4 - ordered genes | |
ok 5 - sample names to column index | |
ok 6 - one block | |
ok 7 - one block reversed | |
ok 8 - one block where there are gaps everywhere | |
ok 9 - no contiguous blocks | |
ok 10 - three blocks | |
ok 11 - three blocks with an inversion in the middle | |
ok 12 - Gene category counts | |
ok 13 - initialise spreadsheet with variable numbers of genes in samples | |
ok 14 - Categories as expected | |
All arguments to easy_init should be either an integer log level or a hash reference. at lib/Bio/Roary/AssemblyStatistics.pm line 42. | |
ok 15 - create output file | |
ok 16 - summary statistics as expected | |
ok 17 - initialise spreadsheet with core of 96.67% | |
ok 18 - Categories as expected with cd of 96.67% | |
ok 19 - initialise spreadsheet with core of 96.66% | |
ok 20 - Categories as expected with cd of 96.66% | |
1..20 | |
t/Bio/Roary/ChunkFastaFile.t | |
ok 1 - use Bio::Roary::ChunkFastaFile; | |
ok 2 - initalise object to produce a single sequence file | |
ok 3 - a single sequence file is created | |
ok 4 - input and output file should be the same | |
ok 5 - initalise object to produce one file per sequence | |
ok 6 - a sequence file per sequence is created | |
ok 7 - the first sequence file is as expected | |
ok 8 - the last sequence file is as expected | |
1..8 | |
t/Bio/Roary/CombinedProteome.t | |
ok 1 - use Bio::Roary::CombinedProteome; | |
ok 2 - initalise object with two files | |
ok 3 - Create a combined file | |
ok 4 - Combined file is as expected | |
ok 5 - non existant files should throw an error | |
1..5 | |
t/Bio/Roary/CommandLine/ExtractProteomeFromGff.t | |
ok 1 - use Bio::Roary::CommandLine::ExtractProteomeFromGff; | |
ok 2 - Actual output file exists empty_file -h | |
ok 3 - Actual and expected output match for '-h' | |
ok 4 - Actual output file exists example_annotation.gff.proteome.faa -t 1 t/data/example_annotation.gff | |
ok 5 - Actual and expected output match for '-t 1 t/data/example_annotation.gff' | |
ok 6 - Actual output file exists example_annotation.gff.proteome.faa t/data/example_annotation.gff | |
ok 7 - Actual and expected output match for 't/data/example_annotation.gff' | |
1..7 | |
t/Bio/Roary/CommandLine/GeneAlignmentFromNucleotides.t | |
ok 1 - use Bio::Roary::CommandLine::GeneAlignmentFromNucleotides; | |
ok 2 - Actual output file exists empty_file -h | |
ok 3 - Actual and expected output match for '-h' | |
ok 4 - Actual output file exists t/data/f.fa.aln t/data/f.fa | |
ok 5 - Actual and expected output match for 't/data/f.fa' | |
ok 6 - Actual output file exists t/data/f.fa.aln --mafft t/data/f.fa | |
ok 7 - Actual and expected output match for '--mafft t/data/f.fa' | |
1..7 | |
t/Bio/Roary/CommandLine/ParallelAllAgainstAllBlastp.t | |
ok 1 - use Bio::Roary::CommandLine::ParallelAllAgainstAllBlastp; | |
ok 2 - Actual output file exists empty_file -h | |
ok 3 - Actual and expected output match for '-h' | |
ok 4 - Actual output file exists blast_results -m /tmp/guix-build-roary-3.6.4.drv-0/source/t/bin/dummy_makeblastdb -b /tmp/guix-build-roary-3.6.4.drv-0/source/t/bin/dummy_blastp -j Local t/data/example_1.faa | |
ok 5 - Actual and expected output match for '-m /tmp/guix-build-roary-3.6.4.drv-0/source/t/bin/dummy_makeblastdb -b /tmp/guix-build-roary-3.6.4.drv-0/source/t/bin/dummy_blastp -j Local t/data/example_1.faa' | |
ok 6 - Actual output file exists different_output_filename -o different_output_filename -m /tmp/guix-build-roary-3.6.4.drv-0/source/t/bin/dummy_makeblastdb -b /tmp/guix-build-roary-3.6.4.drv-0/source/t/bin/dummy_blastp -j Local t/data/example_1.faa | |
ok 7 - Actual and expected output match for '-o different_output_filename -m /tmp/guix-build-roary-3.6.4.drv-0/source/t/bin/dummy_makeblastdb -b /tmp/guix-build-roary-3.6.4.drv-0/source/t/bin/dummy_blastp -j Local t/data/example_1.faa' | |
1..7 | |
t/Bio/Roary/CommandLine/QueryRoary.t | |
ok 1 - use Bio::Roary::CommandLine::QueryRoary; | |
ok 2 - Actual output file exists pan_genome_results_group_2.fa -g t/data/example_groups -a gene_multifasta -n group_2 t/data/example_1.faa t/data/example_2.faa | |
ok 3 - Actual and expected sorted output match for '-g t/data/example_groups -a gene_multifasta -n group_2 t/data/example_1.faa t/data/example_2.faa' | |
ok 4 - Actual output file exists pan_genome_results_group_5.fa -g t/data/example_groups -a gene_multifasta -n group_2,group_5 t/data/example_1.faa t/data/example_2.faa | |
ok 5 - Actual and expected sorted output match for '-g t/data/example_groups -a gene_multifasta -n group_2,group_5 t/data/example_1.faa t/data/example_2.faa' | |
ok 6 - Actual output file exists pan_genome_results_group_2.fa -g t/data/example_groups -a gene_multifasta -n group_2,group_5 t/data/example_1.faa t/data/example_2.faa | |
ok 7 - Actual and expected sorted output match for '-g t/data/example_groups -a gene_multifasta -n group_2,group_5 t/data/example_1.faa t/data/example_2.faa ' | |
ok 8 - Actual output file exists pan_genome_results_group_5.fa -g t/data/example_groups -a gene_multifasta -n group_5 t/data/example_1.faa t/data/example_2.faa | |
ok 9 - Actual and expected sorted output match for '-g t/data/example_groups -a gene_multifasta -n group_5 t/data/example_1.faa t/data/example_2.faa ' | |
ok 10 - Actual output file exists pan_genome_results_group_5.fa -g t/data/example_groups -a gene_multifasta -n group_5,group_2 t/data/example_1.faa t/data/example_2.faa | |
ok 11 - Actual and expected sorted output match for '-g t/data/example_groups -a gene_multifasta -n group_5,group_2 t/data/example_1.faa t/data/example_2.faa ' | |
ok 12 - Actual output file exists pan_genome_results_group_2.fa -g t/data/example_groups -a gene_multifasta -n group_5,group_2 t/data/example_1.faa t/data/example_2.faa | |
ok 13 - Actual and expected sorted output match for '-g t/data/example_groups -a gene_multifasta -n group_5,group_2 t/data/example_1.faa t/data/example_2.faa ' | |
ok 14 - Actual output file exists empty_file -g t/data/example_groups -n group_which_doesnt_exist t/data/example_1.faa t/data/example_2.faa | |
ok 15 - Actual and expected sorted output match for '-g t/data/example_groups -n group_which_doesnt_exist t/data/example_1.faa t/data/example_2.faa' | |
ok 16 - Actual output file exists pan_genome_results -g t/data/query_groups -a complement t/data/query_1.fa t/data/query_2.fa t/data/query_3.fa | |
ok 17 - Actual and expected sorted output match for '-g t/data/query_groups -a complement t/data/query_1.fa t/data/query_2.fa t/data/query_3.fa' | |
ok 18 - Actual output file exists set_difference_common_set -g t/data/query_groups -a difference -i t/data/query_1.fa -t t/data/query_2.fa,t/data/query_3.fa | |
ok 19 - Actual and expected sorted output match for '-g t/data/query_groups -a difference -i t/data/query_1.fa -t t/data/query_2.fa,t/data/query_3.fa' | |
ok 20 - Actual output file exists set_difference_unique_set_two_statistics.csv -g t/data/query_groups -a difference -i t/data/query_1.fa -t t/data/query_2.fa,t/data/query_3.fa | |
ok 21 - Actual and expected sorted output match for '-g t/data/query_groups -a difference -i t/data/query_1.fa -t t/data/query_2.fa,t/data/query_3.fa ' | |
ok 22 - Actual output file exists set_difference_common_set_statistics.csv -g t/data/query_groups -a difference -i t/data/query_1.fa -t t/data/query_2.fa,t/data/query_3.fa | |
ok 23 - Actual and expected sorted output match for '-g t/data/query_groups -a difference -i t/data/query_1.fa -t t/data/query_2.fa,t/data/query_3.fa ' | |
ok 24 - Actual output file exists set_difference_unique_set_one_statistics.csv -g t/data/query_groups -a difference -i t/data/query_1.fa -t t/data/query_2.fa,t/data/query_3.fa | |
ok 25 - Actual and expected sorted output match for '-g t/data/query_groups -a difference -i t/data/query_1.fa -t t/data/query_2.fa,t/data/query_3.fa ' | |
ok 26 - Actual output file exists set_difference_common_set_statistics.csv -g t/data/query_groups -a difference -i t/data/query_1.gff -t t/data/query_2.gff,t/data/query_3.gff | |
ok 27 - Actual and expected sorted output match for '-g t/data/query_groups -a difference -i t/data/query_1.gff -t t/data/query_2.gff,t/data/query_3.gff' | |
ok 28 - Actual output file exists set_difference_unique_set_two -g t/data/query_groups -a difference -i t/data/query_1.fa -t t/data/query_2.fa,t/data/query_3.fa | |
ok 29 - Actual and expected sorted output match for '-g t/data/query_groups -a difference -i t/data/query_1.fa -t t/data/query_2.fa,t/data/query_3.fa' | |
ok 30 - Actual output file exists set_difference_unique_set_one -g t/data/query_groups -a difference -i t/data/query_1.fa -t t/data/query_2.fa,t/data/query_3.fa | |
ok 31 - Actual and expected sorted output match for '-g t/data/query_groups -a difference -i t/data/query_1.fa -t t/data/query_2.fa,t/data/query_3.fa' | |
ok 32 - Actual output file exists pan_genome_results -g t/data/query_groups -a intersection t/data/query_1.fa t/data/query_2.fa t/data/query_3.fa | |
ok 33 - Actual and expected sorted output match for '-g t/data/query_groups -a intersection t/data/query_1.fa t/data/query_2.fa t/data/query_3.fa' | |
ok 34 - Actual output file exists pan_genome_results -g t/data/query_groups -a union t/data/query_1.fa t/data/query_2.fa t/data/query_3.fa | |
ok 35 - Actual and expected sorted output match for '-g t/data/query_groups -a union t/data/query_1.fa t/data/query_2.fa t/data/query_3.fa' | |
ok 36 - Actual output file exists empty_file2 -h | |
ok 37 - Actual and expected sorted output match for '-h' | |
1..37 | |
t/Bio/Roary/CommandLine/Roary.t | |
ok 1 - use Bio::Roary::CommandLine::Roary; | |
ok 2 - use Bio::Roary::CommandLine::CreatePanGenome; | |
ok 3 - Actual output file exists gene_presence_absence.csv --dont_split_groups t/data/query_1.gff t/data/query_2.gff t/data/query_5.gff | |
ok 4 - Actual and expected match output excluding variable columns | |
ok 5 - Actual output file exists gene_presence_absence.csv -j Local --dont_split_groups t/data/genbank_gbff/genbank1.gff t/data/genbank_gbff/genbank2.gff t/data/genbank_gbff/genbank3.gff | |
ok 6 - Actual and expected match output excluding variable columns | |
ok 7 - Actual output file exists gene_presence_absence.csv -j Local -t 1 --dont_split_groups t/data/query_1.gff t/data/query_2.gff t/data/query_5.gff | |
ok 8 - Actual and expected match output excluding variable columns | |
ok 9 - Actual output file exists gene_presence_absence.csv -j Parallel --dont_split_groups t/data/query_1.gff t/data/query_2.gff t/data/query_5.gff | |
ok 10 - Actual and expected match output excluding variable columns | |
ok 11 - Actual output file exists gene_presence_absence.csv -t 1 -j Parallel --dont_split_groups t/data/query_1.gff t/data/query_2.gff t/data/query_5.gff | |
ok 12 - Actual and expected match output excluding variable columns | |
ok 13 - Actual output file exists empty_file -h | |
ok 14 - Actual and expected match output excluding variable columns | |
ok 15 - Actual output file exists clustered_proteins -j Local --dont_split_groups t/data/query_1.gff t/data/query_2.gff t/data/query_5.gff | |
ok 16 - Actual and expected match output excluding variable columns | |
ok 17 - Actual output file exists clustered_proteins -j Parallel --dont_split_groups t/data/query_1.gff t/data/query_2.gff t/data/query_5.gff | |
ok 18 - Actual and expected match output excluding variable columns | |
ok 19 - Check protein query_1.gff.proteome.faa is cleaned up | |
ok 20 - Check protein query_2.gff.proteome.faa is cleaned up | |
ok 21 - Check protein query_5.gff.proteome.faa is cleaned up | |
ok 22 - got expected text Looking for for -a | |
ok 23 - got expected text Output directory created for -v --output_directory t/data/directory_which_doesnt_exist t/data/real_data_1.gff t/data/real_data_2.gff | |
ok 24 - pan genome files should be in directory | |
ok 25 - current working directory should not have changed after script is finished | |
--------------------- WARNING --------------------- | |
MSG: Got a sequence without letters. Could not guess alphabet | |
--------------------------------------------------- | |
--------------------- WARNING --------------------- | |
MSG: Got a sequence without letters. Could not guess alphabet | |
--------------------------------------------------- | |
Core gene file missing: pan_genome_sequences/sigE.fa.aln | |
Core gene file missing: pan_genome_sequences/sopB.fa.aln | |
Core gene file missing: pan_genome_sequences/pepD_2.fa.aln | |
Core gene file missing: pan_genome_sequences/yedV.fa.aln | |
Core gene file missing: pan_genome_sequences/copR.fa.aln | |
Core gene file missing: pan_genome_sequences/uraH.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaC.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaB.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaR.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaG.fa.aln | |
Core gene file missing: pan_genome_sequences/hpcC_1.fa.aln | |
Core gene file missing: pan_genome_sequences/hpcC_2.fa.aln | |
Core gene file missing: pan_genome_sequences/hpcB.fa.aln | |
Core gene file missing: pan_genome_sequences/hpcD.fa.aln | |
Core gene file missing: pan_genome_sequences/hpcG.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaI.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaX.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaA.fa.aln | |
Core gene file missing: pan_genome_sequences/rnz.fa.aln | |
Core gene file missing: pan_genome_sequences/cbpM.fa.aln | |
Core gene file missing: pan_genome_sequences/cbpA.fa.aln | |
Core gene file missing: pan_genome_sequences/scsA.fa.aln | |
Core gene file missing: pan_genome_sequences/scsB.fa.aln | |
Core gene file missing: pan_genome_sequences/scsC.fa.aln | |
Core gene file missing: pan_genome_sequences/resA.fa.aln | |
Core gene file missing: pan_genome_sequences/agp.fa.aln | |
Core gene file missing: pan_genome_sequences/yccJ.fa.aln | |
Core gene file missing: pan_genome_sequences/wrbA.fa.aln | |
Core gene file missing: pan_genome_sequences/group_61.fa.aln | |
Core gene file missing: pan_genome_sequences/rutR.fa.aln | |
Core gene file missing: pan_genome_sequences/group_77.fa.aln | |
Core gene file missing: pan_genome_sequences/putA.fa.aln | |
Core gene file missing: pan_genome_sequences/putP.fa.aln | |
Core gene file missing: pan_genome_sequences/group_62.fa.aln | |
Core gene file missing: pan_genome_sequences/phoH.fa.aln | |
Core gene file missing: pan_genome_sequences/ybbH_2.fa.aln | |
Core gene file missing: pan_genome_sequences/yidK.fa.aln | |
Core gene file missing: pan_genome_sequences/sglT.fa.aln | |
Core gene file missing: pan_genome_sequences/nanE.fa.aln | |
Core gene file missing: pan_genome_sequences/nanM.fa.aln | |
Core gene file missing: pan_genome_sequences/yiiy.fa.aln | |
Core gene file missing: pan_genome_sequences/nanT_3.fa.aln | |
Core gene file missing: pan_genome_sequences/yjhC.fa.aln | |
Core gene file missing: pan_genome_sequences/ghrA.fa.aln | |
Core gene file missing: pan_genome_sequences/ycdX.fa.aln | |
Core gene file missing: pan_genome_sequences/ycdY.fa.aln | |
Core gene file missing: pan_genome_sequences/ycdZ.fa.aln | |
Core gene file missing: pan_genome_sequences/flgL.fa.aln | |
Core gene file missing: pan_genome_sequences/flgK.fa.aln | |
Core gene file missing: pan_genome_sequences/flgJ.fa.aln | |
Core gene file missing: pan_genome_sequences/flgI.fa.aln | |
Core gene file missing: pan_genome_sequences/flgH.fa.aln | |
Core gene file missing: pan_genome_sequences/flgG.fa.aln | |
Core gene file missing: pan_genome_sequences/flgF.fa.aln | |
Core gene file missing: pan_genome_sequences/flgE.fa.aln | |
Core gene file missing: pan_genome_sequences/flgD.fa.aln | |
Core gene file missing: pan_genome_sequences/mdtH.fa.aln | |
Core gene file missing: pan_genome_sequences/bssS.fa.aln | |
Core gene file missing: pan_genome_sequences/solA.fa.aln | |
Core gene file missing: pan_genome_sequences/yceJ.fa.aln | |
Core gene file missing: pan_genome_sequences/yceI_2.fa.aln | |
Core gene file missing: pan_genome_sequences/msyB.fa.aln | |
Core gene file missing: pan_genome_sequences/group_93.fa.aln | |
Core gene file missing: pan_genome_sequences/mdoH.fa.aln | |
Core gene file missing: pan_genome_sequences/mdoG.fa.aln | |
Core gene file missing: pan_genome_sequences/mdoC.fa.aln | |
Core gene file missing: pan_genome_sequences/ybhO_2.fa.aln | |
Core gene file missing: pan_genome_sequences/ymdB.fa.aln | |
Core gene file missing: pan_genome_sequences/group_70.fa.aln | |
Core gene file missing: pan_genome_sequences/csgC.fa.aln | |
Core gene file missing: pan_genome_sequences/csgB.fa.aln | |
Core gene file missing: pan_genome_sequences/csgD.fa.aln | |
Core gene file missing: pan_genome_sequences/csgE.fa.aln | |
Core gene file missing: pan_genome_sequences/csgF.fa.aln | |
Core gene file missing: pan_genome_sequences/csgG.fa.aln | |
not ok 26 - Actual output file exists pan_genome_sequences/mdoH.fa.aln -j Local --dont_delete_files --dont_split_groups --output_multifasta_files t/data/real_data_1.gff t/data/real_data_2.gff | |
# Failed test 'Actual output file exists pan_genome_sequences/mdoH.fa.aln -j Local --dont_delete_files --dont_split_groups --output_multifasta_files t/data/real_data_1.gff t/data/real_data_2.gff' | |
# at /tmp/guix-build-roary-3.6.4.drv-0/source/t/lib/TestHelper.pm line 139. | |
not ok 27 - Actual and expected output match for '-j Local --dont_delete_files --dont_split_groups --output_multifasta_files t/data/real_data_1.gff t/data/real_data_2.gff' | |
# Failed test 'Actual and expected output match for '-j Local --dont_delete_files --dont_split_groups --output_multifasta_files t/data/real_data_1.gff t/data/real_data_2.gff'' | |
# at /tmp/guix-build-roary-3.6.4.drv-0/source/t/lib/TestHelper.pm line 148. | |
# pan_genome_sequences/mdoH.fa.aln absent | |
ok 28 - Core gene alignment exists | |
ok 29 - Check size of the core_gene_alignment.aln init | |
not ok 30 - length of first sequence | |
# Failed test 'length of first sequence' | |
# at t/Bio/Roary/CommandLine/Roary.t line 93. | |
# got: '0' | |
# expected: '64983' | |
ok 31 - Core gene alignment header exists | |
ok 32 | |
ok 33 | |
ok 34 | |
ok 35 | |
ok 36 | |
ok 37 | |
ok 38 | |
--------------------- WARNING --------------------- | |
MSG: Got a sequence without letters. Could not guess alphabet | |
--------------------------------------------------- | |
--------------------- WARNING --------------------- | |
MSG: Got a sequence without letters. Could not guess alphabet | |
--------------------------------------------------- | |
--------------------- WARNING --------------------- | |
MSG: Got a sequence without letters. Could not guess alphabet | |
--------------------------------------------------- | |
Core gene file missing: pan_genome_sequences/group_1.fa.aln | |
Core gene file missing: pan_genome_sequences/group_3.fa.aln | |
ok 39 - Actual output file exists core_gene_alignment.aln -j Local --output_multifasta_files t/data/core_alignment_gene_lookup/query_1.gff t/data/core_alignment_gene_lookup/query_2.gff t/data/core_alignment_gene_lookup/query_3.gff | |
not ok 40 - Actual and expected output match for '-j Local --output_multifasta_files t/data/core_alignment_gene_lookup/query_1.gff t/data/core_alignment_gene_lookup/query_2.gff t/data/core_alignment_gene_lookup/query_3.gff' | |
# Failed test 'Actual and expected output match for '-j Local --output_multifasta_files t/data/core_alignment_gene_lookup/query_1.gff t/data/core_alignment_gene_lookup/query_2.gff t/data/core_alignment_gene_lookup/query_3.gff'' | |
# at /tmp/guix-build-roary-3.6.4.drv-0/source/t/lib/TestHelper.pm line 148. | |
# +---+----------+---+----------------------------------------------------------------+ | |
# | |Got | |Expected | | |
# | Ln| | Ln| | | |
# +---+----------+---+----------------------------------------------------------------+ | |
# | 1|>query_1 | 1|>query_1 | | |
# * 2|\n * 2|ATGAATCTACCTTTACCTGATAATTATGAATTTGTGTTTTTATCTGGTGGATTATCTGGG\n * | |
# | | * 3|CATGCTGCAATGATGTCATTTTTTAATGTTTGTGGCATTGGATATTTGTATCATCATATG * | |
# | | * 4|GATTTAATGAAAAATAGATATATAGATTATTACCATTTTTCTAGGATTGAAAATTTATAT * | |
# | | * 5|TCAATTATAACATATGGACAATACAGTTTAACGCAAGGAATGAATAATATAGGTAAATAT * | |
# | | * 6|TTGACTTTAATTAATAAAATTCCAATTCTTTTTTTGGTAAGAGATCCCATATCAAGACTA * | |
# | | * 7|AAAACCGGAGTAAATCATCCTATTCTAAATCCAAAAAGTATGAAGGAGATATGTTTAAAC * | |
# | | * 8|AATGATTATAGTGATGTGTTTAAGAATAAAATGTATGTTGGCGATATTGGAAAAAATTTT * | |
# | | * 9|TACTATTCAGAAAAGCCAAGCATGAAATATTTACCTAGATTGAAATATGAAAATTTGGGA * | |
# | | * 10|ATATTTTTAAAACCACAAGAATTTGAGCGTTTAAAGCAAGATTCTAAGCTATTTGATGTT * | |
# | | * 11|GCTAAAAGATATTTGAATAATTTTATTGAAGCTTTAGAAGAGAGAATAGACCTAGAAAAA * | |
# | | * 12|GCTAAATTATTTAAAGAAAAAGACGTGTTAAACTATTTAAAAGAAAATAAAGAATTAAGA * | |
# | | * 13|GTTAAGTTAAAAAACATATTAGATAAAGAACTTGTTCATATTAAACAACATCGTCCAGAT * | |
# | | * 14|ATAGTAGCTTCTTGGAAATACTATCAAGAATTTGAACAAATGTGCAAGGAGTTGAATGGT * | |
# | | * 15|AATATTTAG * | |
# | 3|>query_2 | 16|>query_2 | | |
# * 4|\n * 17|ATGAATCTACCTTTACCTGATAATTATGAATTTGTGTTTTTATCTGGTGGATTATCTGGG\n * | |
# | | * 18|CATGCTGCAATGATGTCATTTTTTAATGTTTGTGGCATTGGATATTTGTATCATCATATG * | |
# | | * 19|GATTTAATGAAAAATAGATATATAGATTATTACCATTTTTCTAGGATTGAAAATTTATAT * | |
# | | * 20|TCAATTATAACATATGGACAATACAGTTTAACGCAAGGAATGAATAATATAGGTAAATAT * | |
# | | * 21|TTGACTTTAATTAATNNNNNNNNNATTCTTTTTTTGGTAAGAGATCCCATATCAAGACTA * | |
# | | * 22|AAAACCGGAGTAAATCATCCTATTCTAAATCCAAAAAGTATGAAGGAGATATGTTTAAAC * | |
# | | * 23|AATGATTATAGTGATNNNNNNNNNAATAAAATGTATGTTGGCGATATTGGAAAAAATTTT * | |
# | | * 24|TACTATTCAGAAAAGCCAAGCATGAAATATTTACCTAGATTGAAATATGAAAATTTGGGA * | |
# | | * 25|ATATTTTTAAAACCACAAGAATTTGAGCGTTTAAAGCAAGATTCTAAGCTATTTGATGTT * | |
# | | * 26|GCTAAAAGATATTTGAATAATTTTATTGAAGCTTTAGAAGAGAGAATAGACCTAGAAAAA * | |
# | | * 27|GCTAAATTATTTAAAGAAAAAGACGTGTTAAACTATTTAAAAGAAAATAAAGAATTAAGA * | |
# | | * 28|GTTAAGTTAAAAAACATATTAGATAAAGAACTTGTTCATATTAAACAACATCGTCCAGAT * | |
# | | * 29|ATAGTAGCTTCTTGGAAATACTATCAAGAATTTGAACAAATGTGCAAGGAGTTGAATGGT * | |
# | | * 30|AATATTTAG * | |
# | 5|>query_3 | 31|>query_3 | | |
# * 6|\n * 32|ATGAATCTACCTTTACCTGATAATTATGAATTTGTGTTTTTATCTGGTGGATTATCTGGG\n * | |
# | | * 33|CATGCTGCAATGATGTCATTTTTTAATGTTTGTGGCATTGGATATTTGTATCATCATATG * | |
# | | * 34|GATTTAATGAAAAATAGATATATAGATTATTACCATTTTTCTAGGATTGAAAATTTATAT * | |
# | | * 35|TCAATTATAACATATGGACAATACAGTTTAACGCAAGGAATGAATAATATAGGTAAATAT * | |
# | | * 36|TTGACTTTAATTAATAAAATTCCAATTCTTTTTTTGGTAAGAGATCCCATATCAAGACTA * | |
# | | * 37|AAAACCGGAGTAAATCATCCTATTCTAAATCCAAAAAGTATGAAGGAGATATGTTTAAAC * | |
# | | * 38|AATGATTATAGTGATGTGTTTAAGAATAAAATGTATGTTGGCGATATTGGAAAAAATTTT * | |
# | | * 39|TACTATTCAGAAAAGCCAAGCATGAAATATTTACCTAGATTGAAATATGAAAATTTGGGA * | |
# | | * 40|ATATTTTTAAAACCACAAGAATTCGAGCGTTTAAAGCAAGATTCTAAGCTATTTGATGTT * | |
# | | * 41|GCTAAAAGATATTTGAATAATTTTATTGAAGCTTTAGAAGAGAGAATAGACCTAGAAAAA * | |
# | | * 42|GCTAAATTATTTAAAGAAAAAGACGTGTTAAACTATTTAAAAGAAAATAAAGAATTAAGA * | |
# | | * 43|GTTAAGTTAAAAAACATATTAGATAAAGAACTTGTTCATATTAAACAACATCGTCCAGAT * | |
# | | * 44|ATAGTAGCTTCTTGGAAATACTATCAAGAATTTGAACAAATGTGCAAGGAGTTGAATGGT * | |
# | | * 45|AATATTTAG * | |
# +---+----------+---+----------------------------------------------------------------+ | |
--------------------- WARNING --------------------- | |
MSG: Got a sequence without letters. Could not guess alphabet | |
--------------------------------------------------- | |
--------------------- WARNING --------------------- | |
MSG: Got a sequence without letters. Could not guess alphabet | |
--------------------------------------------------- | |
Core gene file missing: pan_genome_sequences/flgL.fa.aln | |
Core gene file missing: pan_genome_sequences/flgK.fa.aln | |
Core gene file missing: pan_genome_sequences/flgJ.fa.aln | |
Core gene file missing: pan_genome_sequences/flgI.fa.aln | |
Core gene file missing: pan_genome_sequences/flgH.fa.aln | |
Core gene file missing: pan_genome_sequences/flgG.fa.aln | |
Core gene file missing: pan_genome_sequences/flgF.fa.aln | |
Core gene file missing: pan_genome_sequences/flgE.fa.aln | |
Core gene file missing: pan_genome_sequences/flgD.fa.aln | |
Core gene file missing: pan_genome_sequences/mdtH.fa.aln | |
Core gene file missing: pan_genome_sequences/bssS.fa.aln | |
Core gene file missing: pan_genome_sequences/solA.fa.aln | |
Core gene file missing: pan_genome_sequences/yceJ.fa.aln | |
Core gene file missing: pan_genome_sequences/yceI_2.fa.aln | |
Core gene file missing: pan_genome_sequences/msyB.fa.aln | |
Core gene file missing: pan_genome_sequences/group_93.fa.aln | |
Core gene file missing: pan_genome_sequences/mdoH.fa.aln | |
Core gene file missing: pan_genome_sequences/mdoG.fa.aln | |
Core gene file missing: pan_genome_sequences/mdoC.fa.aln | |
Core gene file missing: pan_genome_sequences/ybhO_2.fa.aln | |
Core gene file missing: pan_genome_sequences/ymdB.fa.aln | |
Core gene file missing: pan_genome_sequences/group_59.fa.aln | |
Core gene file missing: pan_genome_sequences/csgC.fa.aln | |
Core gene file missing: pan_genome_sequences/csgB.fa.aln | |
Core gene file missing: pan_genome_sequences/csgD.fa.aln | |
Core gene file missing: pan_genome_sequences/csgE.fa.aln | |
Core gene file missing: pan_genome_sequences/csgF.fa.aln | |
Core gene file missing: pan_genome_sequences/csgG.fa.aln | |
Core gene file missing: pan_genome_sequences/ycdZ.fa.aln | |
Core gene file missing: pan_genome_sequences/ycdY.fa.aln | |
Core gene file missing: pan_genome_sequences/ycdX.fa.aln | |
Core gene file missing: pan_genome_sequences/ghrA.fa.aln | |
Core gene file missing: pan_genome_sequences/yjhC.fa.aln | |
Core gene file missing: pan_genome_sequences/nanT_3.fa.aln | |
Core gene file missing: pan_genome_sequences/yiiy.fa.aln | |
Core gene file missing: pan_genome_sequences/nanM.fa.aln | |
Core gene file missing: pan_genome_sequences/nanE.fa.aln | |
Core gene file missing: pan_genome_sequences/sglT.fa.aln | |
Core gene file missing: pan_genome_sequences/yidK.fa.aln | |
Core gene file missing: pan_genome_sequences/ybbH_2.fa.aln | |
Core gene file missing: pan_genome_sequences/phoH.fa.aln | |
Core gene file missing: pan_genome_sequences/group_51.fa.aln | |
Core gene file missing: pan_genome_sequences/putP.fa.aln | |
Core gene file missing: pan_genome_sequences/putA.fa.aln | |
Core gene file missing: pan_genome_sequences/group_82.fa.aln | |
Core gene file missing: pan_genome_sequences/rutR.fa.aln | |
Core gene file missing: pan_genome_sequences/group_48.fa.aln | |
Core gene file missing: pan_genome_sequences/wrbA.fa.aln | |
Core gene file missing: pan_genome_sequences/yccJ.fa.aln | |
Core gene file missing: pan_genome_sequences/agp.fa.aln | |
Core gene file missing: pan_genome_sequences/resA.fa.aln | |
Core gene file missing: pan_genome_sequences/scsC.fa.aln | |
Core gene file missing: pan_genome_sequences/scsB.fa.aln | |
Core gene file missing: pan_genome_sequences/scsA.fa.aln | |
Core gene file missing: pan_genome_sequences/cbpA.fa.aln | |
Core gene file missing: pan_genome_sequences/cbpM.fa.aln | |
Core gene file missing: pan_genome_sequences/rnz.fa.aln | |
Core gene file missing: pan_genome_sequences/sigE.fa.aln | |
Core gene file missing: pan_genome_sequences/sopB.fa.aln | |
Core gene file missing: pan_genome_sequences/pepD_2.fa.aln | |
Core gene file missing: pan_genome_sequences/yedV.fa.aln | |
Core gene file missing: pan_genome_sequences/copR.fa.aln | |
Core gene file missing: pan_genome_sequences/uraH.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaC.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaB.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaR.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaG.fa.aln | |
Core gene file missing: pan_genome_sequences/hpcC_1.fa.aln | |
Core gene file missing: pan_genome_sequences/hpcC_2.fa.aln | |
Core gene file missing: pan_genome_sequences/hpcB.fa.aln | |
Core gene file missing: pan_genome_sequences/hpcD.fa.aln | |
Core gene file missing: pan_genome_sequences/hpcG.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaI.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaX.fa.aln | |
Core gene file missing: pan_genome_sequences/hpaA.fa.aln | |
not ok 41 - Actual output file exists pan_genome_sequences/mdoH.fa.aln -j Local --dont_delete_files --dont_split_groups --output_multifasta_files --mafft t/data/real_data_1.gff t/data/real_data_2.gff | |
# Failed test 'Actual output file exists pan_genome_sequences/mdoH.fa.aln -j Local --dont_delete_files --dont_split_groups --output_multifasta_files --mafft t/data/real_data_1.gff t/data/real_data_2.gff' | |
# at /tmp/guix-build-roary-3.6.4.drv-0/source/t/lib/TestHelper.pm line 139. | |
not ok 42 - Actual and expected output match for '-j Local --dont_delete_files --dont_split_groups --output_multifasta_files --mafft t/data/real_data_1.gff t/data/real_data_2.gff' | |
# Failed test 'Actual and expected output match for '-j Local --dont_delete_files --dont_split_groups --output_multifasta_files --mafft t/data/real_data_1.gff t/data/real_data_2.gff'' | |
# at /tmp/guix-build-roary-3.6.4.drv-0/source/t/lib/TestHelper.pm line 148. | |
# pan_genome_sequences/mdoH.fa.aln absent | |
ok 43 - Core gene alignment exists | |
ok 44 # skip extended tests not run | |
ok 45 # skip extended tests not run | |
ok 46 # skip extended tests not run | |
ok 47 # skip extended tests not run | |
ok 48 # skip extended tests not run | |
ok 49 # skip extended tests not run | |
ok 50 # skip extended tests not run | |
ok 51 # skip extended tests not run | |
ok 52 # skip extended tests not run | |
ok 53 # skip extended tests not run | |
ok 54 # skip extended tests not run | |
ok 55 # skip extended tests not run | |
ok 56 # skip extended tests not run | |
ok 57 # skip extended tests not run | |
ok 58 # skip extended tests not run | |
ok 59 # skip extended tests not run | |
ok 60 # skip extended tests not run | |
ok 61 # skip extended tests not run | |
ok 62 # skip extended tests not run | |
ok 63 # skip extended tests not run | |
ok 64 # skip extended tests not run | |
ok 65 # skip extended tests not run | |
ok 66 # skip extended tests not run | |
ok 67 # skip extended tests not run | |
ok 68 # skip extended tests not run | |
ok 69 # skip extended tests not run | |
ok 70 # skip extended tests not run | |
ok 71 # skip extended tests not run | |
ok 72 # skip extended tests not run | |
ok 73 # skip extended tests not run | |
ok 74 # skip extended tests not run | |
ok 75 # skip extended tests not run | |
ok 76 # skip extended tests not run | |
ok 77 # skip extended tests not run | |
ok 78 # skip extended tests not run | |
ok 79 # skip extended tests not run | |
ok 80 # skip extended tests not run | |
ok 81 # skip extended tests not run | |
ok 82 # skip extended tests not run | |
ok 83 # skip extended tests not run | |
1..83 | |
# Looks like you failed 6 tests of 83. | |
t/Bio/Roary/CommandLine/RoaryCoreAlignment.t | |
ok 1 - use Bio::Roary::CommandLine::RoaryCoreAlignment; | |
ok 2 - Actual output file exists empty_file -h | |
ok 3 - Actual and expected output match for '-h' | |
ok 4 - Actual output file exists core_gene_alignment.aln -m t/data/core_alignment -s t/data/core_alignment.csv | |
ok 5 - Actual and expected output match for '-m t/data/core_alignment -s t/data/core_alignment.csv' | |
ok 6 - Actual output file exists core_gene_alignment.aln -m t/data/core_alignment -s t/data/core_alignment_core0.66.csv --core_definition 0.66 | |
ok 7 - Actual and expected output match for '-m t/data/core_alignment -s t/data/core_alignment_core0.66.csv --core_definition 0.66' | |
1..7 | |
t/Bio/Roary/CommandLine/RoaryPostAnalysis.t | |
ok 1 - use Bio::Roary::CommandLine::RoaryPostAnalysis; | |
ok 2 # skip Tests dont take variablity into account | |
ok 3 # skip Tests dont take variablity into account | |
1..3 | |
t/Bio/Roary/CommandLine/RoaryReorderSpreadsheet.t | |
ok 1 - use Bio::Roary::CommandLine::RoaryReorderSpreadsheet; | |
ok 2 - Actual output file exists empty_file -h | |
ok 3 - Actual and expected output match for '-h' | |
ok 4 - Actual output file exists reordered_spreadsheet.csv -t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv | |
ok 5 - Actual and expected output match for '-t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv' | |
ok 6 - Actual output file exists reordered_spreadsheet.csv -t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a breadth | |
ok 7 - Actual and expected output match for '-t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a breadth' | |
ok 8 - Actual output file exists reordered_spreadsheet.csv -t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a breadth -b alpha | |
ok 9 - Actual and expected output match for '-t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a breadth -b alpha' | |
ok 10 - Actual output file exists reordered_spreadsheet.csv -t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a breadth -b creation | |
ok 11 - Actual and expected output match for '-t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a breadth -b creation' | |
ok 12 - Actual output file exists reordered_spreadsheet.csv -t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a breadth -b height | |
ok 13 - Actual and expected output match for '-t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a breadth -b height' | |
ok 14 - Actual output file exists reordered_spreadsheet.csv -t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a breadth -b revalpha | |
ok 15 - Actual and expected output match for '-t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a breadth -b revalpha' | |
ok 16 - Actual output file exists reordered_spreadsheet.csv -t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a depth | |
ok 17 - Actual and expected output match for '-t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a depth' | |
ok 18 - Actual output file exists reordered_spreadsheet.csv -t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a depth -b alpha | |
ok 19 - Actual and expected output match for '-t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a depth -b alpha' | |
ok 20 - Actual output file exists reordered_spreadsheet.csv -t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a depth -b creation | |
ok 21 - Actual and expected output match for '-t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a depth -b creation' | |
ok 22 - Actual output file exists reordered_spreadsheet.csv -t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a depth -b height | |
ok 23 - Actual and expected output match for '-t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a depth -b height' | |
ok 24 - Actual output file exists reordered_spreadsheet.csv -t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a depth -b revalpha | |
ok 25 - Actual and expected output match for '-t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -a depth -b revalpha' | |
ok 26 - Actual output file exists reordered_spreadsheet.csv -t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -f newick | |
ok 27 - Actual and expected output match for '-t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -f newick' | |
ok 28 - Actual output file exists different_output_name.csv -t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -o different_output_name.csv | |
ok 29 - Actual and expected output match for '-t t/data/reorder_isolates.tre -s t/data/reorder_isolates_input.csv -o different_output_name.csv' | |
1..29 | |
t/Bio/Roary/CommandLine/TransferAnnotationToGroups.t | |
ok 1 - use Bio::Roary::CommandLine::TransferAnnotationToGroups; | |
ok 2 - Actual output file exists reannotated_groups -g t/data/query_groups t/data/query_1.gff t/data/query_2.gff t/data/query_3.gff | |
ok 3 - Actual and expected sorted output match for '-g t/data/query_groups t/data/query_1.gff t/data/query_2.gff t/data/query_3.gff' | |
ok 4 - Actual output file exists empty_file -h | |
ok 5 - Actual and expected sorted output match for '-h' | |
1..5 | |
t/Bio/Roary/ContigsToGeneIDsFromGFF.t | |
ok 1 - use Bio::Roary::ContigsToGeneIDsFromGFF; | |
ok 2 - Initialise contigs to gene ids obj | |
ok 3 - Contigs match expected with standard output | |
ok 4 - Initialise contigs to gene ids obj with alternative ID patterns | |
ok 5 - Contigs match expected with alternative output | |
ok 6 - Product annotation with non standard format | |
1..6 | |
t/Bio/Roary/EmblGroups.t | |
ok 1 - use Bio::Roary::Output::EmblGroups; | |
ok 2 - initialise embl groups | |
ok 3 - heatmap colour | |
ok 4 - heatmap colour | |
ok 5 - heatmap colour | |
ok 6 - heatmap colour | |
ok 7 - heatmap colour loop over each colour 10 | |
ok 8 - heatmap colour loop over each colour 9 | |
ok 9 - heatmap colour loop over each colour 8 | |
ok 10 - heatmap colour loop over each colour 7 | |
ok 11 - heatmap colour loop over each colour 6 | |
ok 12 - heatmap colour loop over each colour 5 | |
ok 13 - heatmap colour loop over each colour 4 | |
ok 14 - heatmap colour loop over each colour 3 | |
ok 15 - heatmap colour loop over each colour 2 | |
ok 16 - heatmap colour loop over each colour 1 | |
1..16 | |
t/Bio/Roary/External/Blastp.t | |
ok 1 - use Bio::Roary::External::Blastp; | |
ok 2 - initialise object | |
ok 3 - Command constructed as expected | |
ok 4 - run dummy command | |
1..4 | |
t/Bio/Roary/External/Cdhit.t | |
ok 1 - use Bio::Roary::External::Cdhit; | |
ok 2 - initialise object | |
ok 3 - Command constructed as expected | |
ok 4 - run dummy command | |
ok 5 - initialise object with lots of threads | |
ok 6 - number of threads capped at a lower level | |
1..6 | |
t/Bio/Roary/External/CheckTools.t | |
ok 1 - use Bio::Roary::External::CheckTools; | |
ok 2 - initialise checking for tools | |
ok 3 - Check for parallel | |
ok 4 - Check for blastp | |
ok 5 - Check for makeblastdb | |
ok 6 - Check for mcl | |
ok 7 - Check for bedtools | |
ok 8 - Check for prank | |
ok 9 - Check for mafft | |
ok 10 - Check for grep | |
ok 11 - Check for sed | |
ok 12 - Check for awk | |
ok 13 - Check for all tools | |
1..13 | |
t/Bio/Roary/External/Mafft.t | |
ok 1 - use Bio::Roary::External::Mafft; | |
ok 2 - initialise mafft obj | |
ok 3 - Command constructed as expected | |
ok 4 - run mafft | |
ok 5 - output file exists | |
ok 6 - output for mafft matches | |
1..6 | |
t/Bio/Roary/External/Makeblastdb.t | |
ok 1 - use Bio::Roary::External::Makeblastdb; | |
ok 2 - initialise object | |
ok 3 - Command constructed as expected | |
ok 4 - run dummy command | |
1..4 | |
t/Bio/Roary/External/Mcl.t | |
ok 1 - use Bio::Roary::External::Mcl; | |
ok 2 - initialise object with dummy values | |
ok 3 - Command constructed as expected | |
ok 4 - run dummy command | |
ok 5 - initialise object with real values | |
ok 6 - run the real command | |
ok 7 - outgroups as expected | |
1..7 | |
t/Bio/Roary/External/Prank.t | |
ok 1 - use Bio::Roary::External::Prank; | |
ok 2 - initialise prank obj | |
ok 3 - Command constructed as expected | |
ok 4 - run prank | |
ok 5 - output file exists | |
ok 6 - output for prank matches | |
1..6 | |
t/Bio/Roary/ExtractCoreGenesFromSpreadsheet.t | |
ok 1 - use Bio::Roary::ExtractCoreGenesFromSpreadsheet; | |
ok 2 - initalise obj | |
ok 3 - Correct ordering | |
ok 4 - Correct of sample names to genes is correct | |
1..4 | |
t/Bio/Roary/ExtractProteomeFromGFFs.t | |
ok 1 - use Bio::Roary::ExtractProteomeFromGFFs; | |
ok 2 - initialise object | |
ok 3 - one file created | |
ok 4 - content of proteome 1 as expected | |
ok 5 - initialise object where one GFF has no FASTA line | |
ok 6 - content of proteome 1 as expected | |
ok 7 - initialise object with genbank gff files | |
ok 8 - GB files created output | |
ok 9 - content of proteome /tmp/guix-build-roary-3.6.4.drv-0/source/2AKcKqq7N4/genbank1.gff.proteome.faa as expected | |
ok 10 - content of proteome /tmp/guix-build-roary-3.6.4.drv-0/source/2AKcKqq7N4/genbank2.gff.proteome.faa as expected | |
ok 11 - content of proteome /tmp/guix-build-roary-3.6.4.drv-0/source/2AKcKqq7N4/genbank3.gff.proteome.faa as expected | |
ok 12 - initialise object with locus tag id gff files | |
ok 13 - locus tag id files created output | |
ok 14 - content of proteome /tmp/guix-build-roary-3.6.4.drv-0/source/pLyItSXe1A/query_1.gff.proteome.faa as expected | |
ok 15 - content of proteome /tmp/guix-build-roary-3.6.4.drv-0/source/pLyItSXe1A/query_2.gff.proteome.faa as expected | |
ok 16 - content of proteome /tmp/guix-build-roary-3.6.4.drv-0/source/pLyItSXe1A/query_3.gff.proteome.faa as expected | |
1..16 | |
t/Bio/Roary/FilterFullClusters.t | |
ok 1 - use Bio::Roary::FilterFullClusters; | |
ok 2 - initialise object | |
ok 3 - filter the clusters | |
ok 4 - filter original input and save full groups | |
ok 5 - content as expected | |
ok 6 - content as expected | |
ok 7 - content as expected | |
1..7 | |
t/Bio/Roary/GeneNamesFromGFF.t | |
ok 1 - use Bio::Roary::GeneNamesFromGFF; | |
ok 2 - initialise reading GFF file | |
ok 3 - ids to gene names as expected | |
ok 4 - ids to gene lengths as expected | |
ok 5 - initialise reading another GFF file | |
ok 6 - ids to gene names as expected again | |
ok 7 - initialise a GFF file with locus tags only | |
ok 8 - ids to gene names with GFF file with locus tags only | |
1..8 | |
t/Bio/Roary/GroupLabels.t | |
ok 1 - use Bio::Roary::GroupLabels; | |
ok 2 - initialise with a groups file | |
ok 3 - Add labels to groups | |
ok 4 - groups labeled as expected | |
1..4 | |
t/Bio/Roary/GroupStatistics.t | |
ok 1 - use Bio::Roary::GroupStatistics; | |
ok 2 - Initialise group statistics object | |
ok 3 - Create the CSV file | |
ok 4 - CSV file exists | |
ok 5 - Spreadsheet content as expected | |
ok 6 - Create the Rtab file | |
ok 7 - Rtab file exists | |
ok 8 - Rtab matrix content as expected | |
ok 9 - Initialise group statistics object where one isolate has only 1 gene | |
ok 10 - Create the CSV file | |
ok 11 - CSV file exists | |
ok 12 - Spreadsheet content as expected with missing genes | |
ok 13 - Initialise group statistics object | |
ok 14 - Create the CSV file | |
ok 15 - CSV file exists | |
ok 16 - Verbose spreadsheet content as expected | |
1..16 | |
t/Bio/Roary/InflateClusters.t | |
ok 1 - use Bio::Roary::InflateClusters; | |
ok 2 - initialise object | |
ok 3 - inflate the results | |
ok 4 - inflated results as expected | |
ok 5 - initialise object | |
ok 6 - inflate the results | |
ok 7 - inflated results as expected | |
1..7 | |
t/Bio/Roary/OrderGenes.t | |
ok 1 - use Bio::Roary::OrderGenes; | |
ok 2 - Initialise order genes object for t/data/accessory_graphs/no_accessory | |
ok 3 - build the graph | |
ok 4 - group group_A found in file t/data/accessory_graphs/no_accessory | |
ok 5 - group group_A is core so shouldnt have any accessory labels | |
ok 6 - group group_B found in file t/data/accessory_graphs/no_accessory | |
ok 7 - group group_B is core so shouldnt have any accessory labels | |
ok 8 - group group_C found in file t/data/accessory_graphs/no_accessory | |
ok 9 - group group_C is core so shouldnt have any accessory labels | |
ok 10 - core accessory graph created | |
ok 11 - accessory graph created | |
ok 12 - Initialise order genes object for t/data/accessory_graphs/no_accessory | |
ok 13 - build the graph | |
ok 14 - group group_A found in file t/data/accessory_graphs/no_accessory | |
ok 15 - group group_A is core so shouldnt have any accessory labels | |
ok 16 - group group_B found in file t/data/accessory_graphs/no_accessory | |
ok 17 - group group_B is core so shouldnt have any accessory labels | |
ok 18 - group group_C found in file t/data/accessory_graphs/no_accessory | |
ok 19 - group group_C is core so shouldnt have any accessory labels | |
ok 20 - core accessory graph created | |
ok 21 - accessory graph created | |
ok 22 - Initialise order genes object for t/data/accessory_graphs/one_bubble | |
ok 23 - build the graph | |
ok 24 - group group_C found in file t/data/accessory_graphs/one_bubble | |
ok 25 - group group_C is core so shouldnt have any accessory labels | |
ok 26 - group group_E found in file t/data/accessory_graphs/one_bubble | |
ok 27 - group group_E is core so shouldnt have any accessory labels | |
ok 28 - group group_bubble_1 found in file t/data/accessory_graphs/one_bubble | |
ok 29 - group group_bubble_1 is accessory so should have accessory label | |
ok 30 - group group_bubble_2 found in file t/data/accessory_graphs/one_bubble | |
ok 31 - group group_bubble_2 is accessory so should have accessory label | |
ok 32 - group group_F found in file t/data/accessory_graphs/one_bubble | |
ok 33 - group group_F is accessory so should have accessory label | |
ok 34 - group group_G found in file t/data/accessory_graphs/one_bubble | |
ok 35 - group group_G is core so shouldnt have any accessory labels | |
ok 36 - core accessory graph created | |
ok 37 - accessory graph created | |
ok 38 - Initialise order genes object for t/data/accessory_graphs/one_bubble | |
ok 39 - build the graph | |
ok 40 - group group_C found in file t/data/accessory_graphs/one_bubble | |
ok 41 - group group_C is core so shouldnt have any accessory labels | |
ok 42 - group group_E found in file t/data/accessory_graphs/one_bubble | |
ok 43 - group group_E is core so shouldnt have any accessory labels | |
ok 44 - group group_bubble_1 found in file t/data/accessory_graphs/one_bubble | |
ok 45 - group group_bubble_1 is accessory so should have accessory label | |
ok 46 - group group_bubble_2 found in file t/data/accessory_graphs/one_bubble | |
ok 47 - group group_bubble_2 is accessory so should have accessory label | |
ok 48 - group group_F found in file t/data/accessory_graphs/one_bubble | |
ok 49 - group group_F is core so shouldnt have any accessory labels | |
ok 50 - group group_G found in file t/data/accessory_graphs/one_bubble | |
ok 51 - group group_G is core so shouldnt have any accessory labels | |
ok 52 - core accessory graph created | |
ok 53 - accessory graph created | |
ok 54 - Initialise order genes object for t/data/accessory_graphs/one_branch | |
ok 55 - build the graph | |
ok 56 - group group_A found in file t/data/accessory_graphs/one_branch | |
ok 57 - group group_A is core so shouldnt have any accessory labels | |
ok 58 - group group_B1 found in file t/data/accessory_graphs/one_branch | |
ok 59 - group group_B1 is accessory so should have accessory label | |
ok 60 - group group_B2 found in file t/data/accessory_graphs/one_branch | |
ok 61 - group group_B2 is accessory so should have accessory label | |
ok 62 - group group_C found in file t/data/accessory_graphs/one_branch | |
ok 63 - group group_C is core so shouldnt have any accessory labels | |
ok 64 - group group_E found in file t/data/accessory_graphs/one_branch | |
ok 65 - group group_E is core so shouldnt have any accessory labels | |
ok 66 - core accessory graph created | |
ok 67 - accessory graph created | |
ok 68 - Initialise order genes object for t/data/accessory_graphs/one_branch | |
ok 69 - build the graph | |
ok 70 - group group_A found in file t/data/accessory_graphs/one_branch | |
ok 71 - group group_A is core so shouldnt have any accessory labels | |
ok 72 - group group_B1 found in file t/data/accessory_graphs/one_branch | |
ok 73 - group group_B1 is accessory so should have accessory label | |
ok 74 - group group_B2 found in file t/data/accessory_graphs/one_branch | |
ok 75 - group group_B2 is core so shouldnt have any accessory labels | |
ok 76 - group group_C found in file t/data/accessory_graphs/one_branch | |
ok 77 - group group_C is core so shouldnt have any accessory labels | |
ok 78 - group group_E found in file t/data/accessory_graphs/one_branch | |
ok 79 - group group_E is core so shouldnt have any accessory labels | |
ok 80 - core accessory graph created | |
ok 81 - accessory graph created | |
ok 82 - Initialise order genes object for t/data/accessory_graphs/two_graphs | |
ok 83 - build the graph | |
ok 84 - group group_A found in file t/data/accessory_graphs/two_graphs | |
ok 85 - group group_A is core so shouldnt have any accessory labels | |
ok 86 - group group_B found in file t/data/accessory_graphs/two_graphs | |
ok 87 - group group_B is core so shouldnt have any accessory labels | |
ok 88 - group group_G found in file t/data/accessory_graphs/two_graphs | |
ok 89 - group group_G is core so shouldnt have any accessory labels | |
ok 90 - group group_H found in file t/data/accessory_graphs/two_graphs | |
ok 91 - group group_H is core so shouldnt have any accessory labels | |
ok 92 - core accessory graph created | |
ok 93 - accessory graph created | |
ok 94 - Initialise order genes object for t/data/accessory_graphs/two_graphs | |
ok 95 - build the graph | |
ok 96 - group group_A found in file t/data/accessory_graphs/two_graphs | |
ok 97 - group group_A is core so shouldnt have any accessory labels | |
ok 98 - group group_B found in file t/data/accessory_graphs/two_graphs | |
ok 99 - group group_B is core so shouldnt have any accessory labels | |
ok 100 - group group_G found in file t/data/accessory_graphs/two_graphs | |
ok 101 - group group_G is core so shouldnt have any accessory labels | |
ok 102 - group group_H found in file t/data/accessory_graphs/two_graphs | |
ok 103 - group group_H is core so shouldnt have any accessory labels | |
ok 104 - core accessory graph created | |
ok 105 - accessory graph created | |
ok 106 - Initialise order genes object for t/data/accessory_graphs/single_gene_contig | |
ok 107 - build the graph | |
ok 108 - group group_A found in file t/data/accessory_graphs/single_gene_contig | |
ok 109 - group group_A is core so shouldnt have any accessory labels | |
ok 110 - core accessory graph created | |
ok 111 - accessory graph created | |
ok 112 - Initialise order genes object for t/data/accessory_graphs/single_gene_contig | |
ok 113 - build the graph | |
ok 114 - group group_A found in file t/data/accessory_graphs/single_gene_contig | |
ok 115 - group group_A is core so shouldnt have any accessory labels | |
ok 116 - core accessory graph created | |
ok 117 - accessory graph created | |
ok 118 - Initialise order genes object for t/data/accessory_graphs/core_deletion | |
ok 119 - build the graph | |
ok 120 - group group_A found in file t/data/accessory_graphs/core_deletion | |
ok 121 - group group_A is core so shouldnt have any accessory labels | |
ok 122 - group group_B found in file t/data/accessory_graphs/core_deletion | |
ok 123 - group group_B is core so shouldnt have any accessory labels | |
ok 124 - group group_C found in file t/data/accessory_graphs/core_deletion | |
ok 125 - group group_C is core so shouldnt have any accessory labels | |
ok 126 - group group_D found in file t/data/accessory_graphs/core_deletion | |
ok 127 - group group_D is accessory so should have accessory label | |
ok 128 - group group_E found in file t/data/accessory_graphs/core_deletion | |
ok 129 - group group_E is accessory so should have accessory label | |
ok 130 - group group_F found in file t/data/accessory_graphs/core_deletion | |
ok 131 - group group_F is accessory so should have accessory label | |
ok 132 - group group_G found in file t/data/accessory_graphs/core_deletion | |
ok 133 - group group_G is core so shouldnt have any accessory labels | |
ok 134 - group group_H found in file t/data/accessory_graphs/core_deletion | |
ok 135 - group group_H is core so shouldnt have any accessory labels | |
ok 136 - core accessory graph created | |
ok 137 - accessory graph created | |
ok 138 - Initialise order genes object for t/data/accessory_graphs/core_deletion | |
ok 139 - build the graph | |
ok 140 - group group_A found in file t/data/accessory_graphs/core_deletion | |
ok 141 - group group_A is core so shouldnt have any accessory labels | |
ok 142 - group group_B found in file t/data/accessory_graphs/core_deletion | |
ok 143 - group group_B is core so shouldnt have any accessory labels | |
ok 144 - group group_C found in file t/data/accessory_graphs/core_deletion | |
ok 145 - group group_C is core so shouldnt have any accessory labels | |
ok 146 - group group_D found in file t/data/accessory_graphs/core_deletion | |
ok 147 - group group_D is accessory so should have accessory label | |
ok 148 - group group_E found in file t/data/accessory_graphs/core_deletion | |
ok 149 - group group_E is accessory so should have accessory label | |
ok 150 - group group_F found in file t/data/accessory_graphs/core_deletion | |
ok 151 - group group_F is accessory so should have accessory label | |
ok 152 - group group_G found in file t/data/accessory_graphs/core_deletion | |
ok 153 - group group_G is core so shouldnt have any accessory labels | |
ok 154 - group group_H found in file t/data/accessory_graphs/core_deletion | |
ok 155 - group group_H is core so shouldnt have any accessory labels | |
ok 156 - core accessory graph created | |
ok 157 - accessory graph created | |
ok 158 - Initialise order genes object for t/data/accessory_graphs/core_island | |
ok 159 - build the graph | |
ok 160 - group group_A found in file t/data/accessory_graphs/core_island | |
ok 161 - group group_A is accessory so should have accessory label | |
ok 162 - group group_B found in file t/data/accessory_graphs/core_island | |
ok 163 - group group_B is accessory so should have accessory label | |
ok 164 - group group_C found in file t/data/accessory_graphs/core_island | |
ok 165 - group group_C is accessory so should have accessory label | |
ok 166 - group group_D found in file t/data/accessory_graphs/core_island | |
ok 167 - group group_D is core so shouldnt have any accessory labels | |
ok 168 - group group_E found in file t/data/accessory_graphs/core_island | |
ok 169 - group group_E is core so shouldnt have any accessory labels | |
ok 170 - group group_F found in file t/data/accessory_graphs/core_island | |
ok 171 - group group_F is core so shouldnt have any accessory labels | |
ok 172 - group group_G found in file t/data/accessory_graphs/core_island | |
ok 173 - group group_G is accessory so should have accessory label | |
ok 174 - group group_H found in file t/data/accessory_graphs/core_island | |
ok 175 - group group_H is accessory so should have accessory label | |
ok 176 - core accessory graph created | |
ok 177 - accessory graph created | |
ok 178 - Initialise order genes object for t/data/accessory_graphs/core_island | |
ok 179 - build the graph | |
ok 180 - group group_A found in file t/data/accessory_graphs/core_island | |
ok 181 - group group_A is accessory so should have accessory label | |
ok 182 - group group_B found in file t/data/accessory_graphs/core_island | |
ok 183 - group group_B is accessory so should have accessory label | |
ok 184 - group group_C found in file t/data/accessory_graphs/core_island | |
ok 185 - group group_C is accessory so should have accessory label | |
ok 186 - group group_D found in file t/data/accessory_graphs/core_island | |
ok 187 - group group_D is core so shouldnt have any accessory labels | |
ok 188 - group group_E found in file t/data/accessory_graphs/core_island | |
ok 189 - group group_E is core so shouldnt have any accessory labels | |
ok 190 - group group_F found in file t/data/accessory_graphs/core_island | |
ok 191 - group group_F is core so shouldnt have any accessory labels | |
ok 192 - group group_G found in file t/data/accessory_graphs/core_island | |
ok 193 - group group_G is accessory so should have accessory label | |
ok 194 - group group_H found in file t/data/accessory_graphs/core_island | |
ok 195 - group group_H is accessory so should have accessory label | |
ok 196 - core accessory graph created | |
ok 197 - accessory graph created | |
ok 198 - Initialise order genes object for sample weights | |
ok 199 - build the graph for sample weights | |
ok 200 - core accessory graph created for sample weights | |
ok 201 - accessory graph created for sample weights | |
ok 202 - graph weights changed | |
ok 203 - graphs reordered as expected | |
1..203 | |
t/Bio/Roary/Output/CoreGeneAlignmentCoorindatesEMBL.t | |
ok 1 - use Bio::Roary::Output::CoreGeneAlignmentCoordinatesEMBL; | |
ok 2 - initialise core gene obj | |
ok 3 - Get gene name with directory | |
ok 4 - Get gene name with no directory | |
ok 5 - Get gene name where theres no extension | |
ok 6 - Get gene name with partial extension | |
ok 7 - create the embl header file | |
ok 8 - content of embl file as expected | |
ok 9 - next coordinate | |
1..9 | |
t/Bio/Roary/Output/DifferenceBetweenSets.t | |
ok 1 - use Bio::Roary::Output::DifferenceBetweenSets; | |
ok 2 - initialise set difference obj | |
ok 3 - create set one unique | |
ok 4 - create set two unique | |
ok 5 - create common set unique | |
ok 6 - set one file content as expected | |
ok 7 - set two file content as expected | |
ok 8 - common set file content as expected | |
1..8 | |
t/Bio/Roary/Output/GroupsMultifastaProtein.t | |
ok 1 - use Bio::Roary::Output::GroupsMultifastaProtein; | |
ok 2 - initialise creating the nuc fasta obj | |
ok 3 - perform the conversion | |
ok 4 - File content as expected | |
1..4 | |
t/Bio/Roary/Output/GroupsMultifastas.t | |
ok 1 - use Bio::Roary::Output::GroupsMultifastas; | |
ok 2 - initialise creating multiple fastas | |
ok 3 - Create multiple fasta files | |
ok 4 - output_groups_group_2.fa group created | |
ok 5 - output_groups_group_2.fa group created | |
ok 6 - group 2 contect as expected | |
ok 7 - group 5 contect as expected | |
1..7 | |
t/Bio/Roary/Output/GroupsMultifastasNucleotide.t | |
ok 1 - use Bio::Roary::Output::GroupsMultifastasNucleotide; | |
ok 2 | |
ok 3 - initialise creating multiple fastas where you dont delete non core files | |
ok 4 - Create multiple fasta files where you dont delete non core files | |
not ok 5 - Check multifasta content is correct for 3-hly.fa | |
# Failed test 'Check multifasta content is correct for 3-hly.fa' | |
# at t/Bio/Roary/Output/GroupsMultifastasNucleotide.t line 42. | |
# pan_genome_sequences/hly.fa absent | |
not ok 6 - Check multifasta content is correct for 2-speH.fa | |
# Failed test 'Check multifasta content is correct for 2-speH.fa' | |
# at t/Bio/Roary/Output/GroupsMultifastasNucleotide.t line 43. | |
# pan_genome_sequences/speH.fa absent | |
not ok 7 - Check multifasta content is correct for 2-argF.fa | |
# Failed test 'Check multifasta content is correct for 2-argF.fa' | |
# at t/Bio/Roary/Output/GroupsMultifastasNucleotide.t line 44. | |
# pan_genome_sequences/argF.fa absent | |
not ok 8 - pan genome reference file created | |
# Failed test 'pan genome reference file created' | |
# at t/Bio/Roary/Output/GroupsMultifastasNucleotide.t line 45. | |
not ok 9 - pan genome reference as expected | |
# Failed test 'pan genome reference as expected' | |
# at t/Bio/Roary/Output/GroupsMultifastasNucleotide.t line 46. | |
# pan_genome_reference.fa absent | |
ok 10 - initialise creating multiple fastas where you delete non core files | |
ok 11 - Create multiple fasta files where you delete non core files | |
not ok 12 - Check multifasta content is correct for 3-hly.fa | |
# Failed test 'Check multifasta content is correct for 3-hly.fa ' | |
# at t/Bio/Roary/Output/GroupsMultifastasNucleotide.t line 62. | |
# pan_genome_sequences/hly.fa absent | |
ok 13 - Check 2-speH.fa doesnt exist since its non core | |
ok 14 - Check 2-argF.fa doesnt exist since its non core | |
ok 15 - initialise creating multiple fastas | |
ok 16 - multifasta creation fails when group limit exceeded | |
1..16 | |
# Looks like you failed 6 tests of 16. | |
t/Bio/Roary/Output/NumberOfGroups.t | |
ok 1 - use Bio::Roary::Output::NumberOfGroups; | |
ok 2 - initialise object | |
ok 3 - create the raw output file | |
ok 4 - check raw output file created | |
ok 5 - Content of total groups tab file as expected | |
ok 6 - check raw output file created | |
ok 7 - | |
ok 8 - check raw output file created | |
ok 9 - Content of total groups tab file as expected | |
ok 10 - check raw output file created | |
ok 11 - Content of unique groups tab file as expected | |
ok 12 - initialise object with 60 percent core definition | |
ok 13 - create the raw output files for 60 percent core def | |
ok 14 - Content of conserved genes with 60 percent core def | |
1..14 | |
t/Bio/Roary/Output/QueryGroups.t | |
ok 1 - use Bio::Roary::Output::QueryGroups; | |
ok 2 - initialise groups query object | |
ok 3 - create the union file | |
ok 4 - create the intersection file | |
ok 5 - create the complement file | |
ok 6 - contents of the union groups as expected | |
ok 7 - contents of the intersection groups as expected | |
ok 8 - contents of the complement groups as expected | |
ok 9 - initialise groups query object | |
ok 10 - create the intersection file | |
ok 11 - create the complement file | |
ok 12 - contents of the intersection groups as expected | |
ok 13 - contents of the complement groups as expected | |
ok 14 - initialise groups query object with paralogs | |
ok 15 - create the intersection file | |
ok 16 - contents of the intersection groups with paralogs as expected | |
1..16 | |
t/Bio/Roary/ParallelAllAgainstAllBlast.t | |
ok 1 - use Bio::Roary::ParallelAllAgainstAllBlast; | |
ok 2 - initialise obj with mocked external applications | |
ok 3 - Run locally | |
ok 4 - Combined blast results | |
1..4 | |
t/Bio/Roary/PrepareInputFiles.t | |
ok 1 - use Bio::Roary::PrepareInputFiles; | |
ok 2 - initalise | |
ok 3 - proteome extracted from gff files, input fasta files filtered | |
ok 4 - previously created faa file looked up from gff filename | |
1..4 | |
t/Bio/Roary/PresenceAbsenceMatrix.t | |
ok 1 - use Bio::Roary::PresenceAbsenceMatrix; | |
ok 2 - initialise object | |
ok 3 - create matrix file | |
ok 4 - matrix file exists | |
ok 5 - Rtab matrix content as expected | |
ok 6 - initialise object one gene one group | |
ok 7 - create matrix file one gene one group | |
ok 8 - Rtab matrix content as expected for one gene one group | |
1..8 | |
t/Bio/Roary/QC/Report.t | |
ok 1 - use Bio::Roary::QC::Report; | |
ok 2 - QC report object created with no input gff files | |
ok 3 - report generated | |
ok 4 - report file exists | |
ok 5 - report file correct | |
ok 6 - QC report object created with data | |
ok 7 - filename of nuc from gff | |
ok 8 - extract nuc command | |
ok 9 - extract nuc files from gffs | |
ok 10 - check extracted nuc files from gffs list | |
ok 11 - Check FASTA file 1 extracted as expected | |
ok 12 - Check FASTA file 2 extracted as expected | |
ok 13 # skip kraken not installed | |
ok 14 # skip kraken not installed | |
1..14 | |
t/Bio/Roary/ReformatInputGFFs.t | |
ok 1 - use Bio::Roary::ReformatInputGFFs; | |
ok 2 - initialise with one input gff | |
ok 3 - fix duplicates with one input gff | |
ok 4 - list of gff files with one input gff, nothing should change | |
ok 5 - Directory shouldnt exist because there arent any fixed input files | |
ok 6 - initialise with 2 input gffs | |
ok 7 - Directory shouldnt exist before running | |
ok 8 - extract ids | |
ok 9 - extract ids | |
All arguments to easy_init should be either an integer log level or a hash reference. at lib/Bio/Roary/ReformatInputGFFs.pm line 36. | |
ok 10 - fix duplicates with 2 input gffs | |
ok 11 - Directory should exist because there is one gff thats fixed | |
ok 12 - list of gff files one in the fixed directory | |
ok 13 - fixed file should exist | |
ok 14 - fixed file should have expected changes | |
ok 15 - initialise with 3 input gffs | |
ok 16 - Directory shouldnt exist before running | |
All arguments to easy_init should be either an integer log level or a hash reference. at lib/Bio/Roary/ReformatInputGFFs.pm line 36. | |
ok 17 - fix duplicates with 3 input gffs | |
ok 18 - Directory should exist because there is 2 gffs thats fixed | |
ok 19 - list of gff files 2 in the fixed directory | |
ok 20 - fixed file should exist | |
ok 21 - fixed file should exist | |
ok 22 - fixed file should have expected changes | |
ok 23 - fixed file should have expected changes | |
ok 24 - initialise with 1 gff that has shown to have a bug | |
ok 25 - fix duplicates | |
ok 26 - fixed file should exist | |
ok 27 - fixed file should have expected changes | |
1..27 | |
t/Bio/Roary/ReorderSpreadsheet.t | |
ok 1 - use Bio::Roary::ReorderSpreadsheet; | |
ok 2 - initialise reordering the spreadsheet | |
ok 3 - Column mappings with fixed in same order and end columns ordered by tree file | |
ok 4 - run the reorder method | |
ok 5 - check the output file exists | |
ok 6 - content of the spreadsheet as expected | |
1..6 | |
t/Bio/Roary/SampleOrder.t | |
ok 1 - use Bio::Roary::SampleOrder; | |
ok 2 - initialise sample order object | |
ok 3 - order of sample names matches the tree | |
ok 4 - initialise sample order object with raxml tree | |
ok 5 - order of sample names matches the raxml tree | |
1..5 | |
t/Bio/Roary/SequenceLengths.t | |
ok 1 - use Bio::Roary::SequenceLengths; | |
ok 2 - Initialise object | |
ok 3 - hash with lengths of each sequence | |
1..3 | |
t/Bio/Roary/SortFasta.t | |
ok 1 - use Bio::Roary::SortFasta; | |
ok 2 - initalise object | |
ok 3 - sort the fasta file | |
ok 4 - the new file exists | |
ok 5 - check order of sorted fasta | |
ok 6 - initalise object with uneven sequences | |
ok 7 - sort the fasta file | |
ok 8 - output sequences are now divisible by three | |
ok 9 - initalise object with alignment with nnn at end | |
ok 10 - sort the fasta file and remove nnn at end | |
ok 11 - output sequences are now divisible by three | |
ok 12 - initalise object with uneven sequences and remove nnn from end but nothing to remove | |
ok 13 - sort the fasta file | |
ok 14 - output sequences are now divisible by three and no nnn removed | |
ok 15 - totally different | |
ok 16 - all the same | |
ok 17 - half different | |
ok 18 - first half the same | |
1..18 | |
t/Bio/Roary/SplitGroups.t | |
ok 1 - use Bio::Roary::SplitGroups; | |
ok 2 - initalise object | |
ok 3 - output file exists | |
ok 4 - split group output correct for test 1 | |
ok 5 - initalise object | |
ok 6 - output file exists | |
ok 7 - split group output correct for test 2 | |
ok 8 - initalise object | |
ok 9 - output file exists | |
ok 10 - split group output correct for test 3 | |
ok 11 - initalise object | |
ok 12 - output file exists | |
ok 13 - split group output correct for test 4 | |
1..13 | |
phase `check' failed after 320.5 seconds |
Sign up for free
to join this conversation on GitHub.
Already have an account?
Sign in to comment