Skip to content

Instantly share code, notes, and snippets.

Embed
What would you like to do?
Pfeiffer syndrom quartet analysis
{
"cells": [
{
"cell_type": "markdown",
"metadata": {},
"source": [
"# Pfeiffer syndrom quartet analysis"
]
},
{
"cell_type": "code",
"execution_count": 1,
"metadata": {
"collapsed": true
},
"outputs": [],
"source": [
"%matplotlib inline\n",
"import numpy as np\n",
"import pandas as pd\n",
"import matplotlib.pyplot as plt"
]
},
{
"cell_type": "code",
"execution_count": 2,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"##fileformat=VCFv4.1\r\n",
"##ApplyRecalibration=\"analysis_type=ApplyRecalibration input_file=[] read_buffer_size=null phone_home=STANDARD gatk_key=null read_filter=[] intervals=null excludeIntervals=null interval_set_rule=UNION interval_merging=ALL interval_padding=0 reference_sequence=/tmp/generate_APPLY_RECALIBRATOR.py/d2cd22743d3eea79f59dd21ebb84a0d7/human_g1k_v37.fasta nonDeterministicRandomSeed=false downsampling_type=BY_SAMPLE downsample_to_fraction=null downsample_to_coverage=1000 baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false BQSR=null quantize_quals=0 disable_indel_quals=false emit_original_quals=false preserve_qscores_less_than=6 defaultBaseQualities=-1 validation_strictness=SILENT remove_program_records=false keep_program_records=false unsafe=null num_threads=1 num_cpu_threads=null num_io_threads=null num_bam_file_handles=null read_group_black_list=null pedigree=[] pedigreeString=[] pedigreeValidationType=STRICT allow_intervals_with_unindexed_bam=false generateShadowBCF=false logging_level=INFO log_to_file=/storage/gluster/insilico/data/GenomicsData/Series//ISDB11122GPL11154/apply_recalibrator/d2cd22743d3eea79f59dd21ebb84a0d7/SM.recal.snps.vcf.log help=false input=[(RodBinding name=input source=/tmp/generate_APPLY_RECALIBRATOR.py/d2cd22743d3eea79f59dd21ebb84a0d7/ISDB11122.snps.raw.vcf)] recal_file=(RodBinding name=recal_file source=/tmp/generate_APPLY_RECALIBRATOR.py/d2cd22743d3eea79f59dd21ebb84a0d7/ISDB11122.snps.VarRecal.recal) tranches_file=/tmp/generate_APPLY_RECALIBRATOR.py/d2cd22743d3eea79f59dd21ebb84a0d7/ISDB11122.snps.VarRecal.tranches out=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub no_cmdline_in_header=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub bcf=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub ts_filter_level=99.0 ignore_filter=null mode=SNP filter_mismatching_base_and_quals=false\"\r\n",
"##CombineVariants=\"analysis_type=CombineVariants input_file=[] read_buffer_size=null phone_home=STANDARD gatk_key=null read_filter=[] intervals=null excludeIntervals=null interval_set_rule=UNION interval_merging=ALL interval_padding=0 reference_sequence=/tmp/generate_COMBINE_VARIANTS.py/00e90c599e331929a09028693bed91f7/human_g1k_v37.fasta nonDeterministicRandomSeed=false downsampling_type=BY_SAMPLE downsample_to_fraction=null downsample_to_coverage=1000 baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false BQSR=null quantize_quals=0 disable_indel_quals=false emit_original_quals=false preserve_qscores_less_than=6 defaultBaseQualities=-1 validation_strictness=SILENT remove_program_records=false keep_program_records=false unsafe=null num_threads=1 num_cpu_threads=null num_io_threads=null num_bam_file_handles=null read_group_black_list=null pedigree=[] pedigreeString=[] pedigreeValidationType=STRICT allow_intervals_with_unindexed_bam=false generateShadowBCF=false logging_level=INFO log_to_file=/storage/gluster/insilico/data/GenomicsData/Series//ISDB11122GPL11154/combine_variants/00e90c599e331929a09028693bed91f7/ISDB11122.SNPrecal.IndelFiltered.vcf.log help=false variant=[(RodBinding name=variant source=/tmp/generate_COMBINE_VARIANTS.py/00e90c599e331929a09028693bed91f7/ISDB11122.indel.filtered.vcf), (RodBinding name=variant2 source=/tmp/generate_COMBINE_VARIANTS.py/00e90c599e331929a09028693bed91f7/SM.recal.snps.vcf)] out=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub no_cmdline_in_header=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub bcf=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub genotypemergeoption=UNSORTED filteredrecordsmergetype=KEEP_IF_ANY_UNFILTERED multipleallelesmergetype=BY_TYPE rod_priority_list=null printComplexMerges=false filteredAreUncalled=false minimalVCF=false setKey=set assumeIdenticalSamples=false minimumN=1 suppressCommandLineHeader=false mergeInfoWithMaxAC=false filter_mismatching_base_and_quals=false\"\r\n",
"##FILTER=<ID=GATKStandard,Description=\"QD < 2.0 || ReadPosRankSum < -20.0 || FS > 200.0\">\r\n",
"##FILTER=<ID=LowQual,Description=\"Low quality\">\r\n",
"##FILTER=<ID=VQSRTrancheSNP99.00to99.90,Description=\"Truth sensitivity tranche level for SNP model at VQS Lod: -5.6494 <= x < 1.6606\">\r\n",
"##FILTER=<ID=VQSRTrancheSNP99.90to100.00+,Description=\"Truth sensitivity tranche level for SNP model at VQS Lod < -2277.7485\">\r\n",
"##FILTER=<ID=VQSRTrancheSNP99.90to100.00,Description=\"Truth sensitivity tranche level for SNP model at VQS Lod: -2277.7485 <= x < -5.6494\">\r\n",
"##FORMAT=<ID=AD,Number=.,Type=Integer,Description=\"Allelic depths for the ref and alt alleles in the order listed\">\r\n",
"##FORMAT=<ID=DP,Number=1,Type=Integer,Description=\"Approximate read depth (reads with MQ=255 or with bad mates are filtered)\">\r\n",
"##FORMAT=<ID=GQ,Number=1,Type=Integer,Description=\"Genotype Quality\">\r\n",
"##FORMAT=<ID=GT,Number=1,Type=String,Description=\"Genotype\">\r\n",
"##FORMAT=<ID=PL,Number=G,Type=Integer,Description=\"Normalized, Phred-scaled likelihoods for genotypes as defined in the VCF specification\">\r\n",
"##INFO=<ID=ABHet,Number=1,Type=Float,Description=\"Allele Balance for hets (ref/(ref+alt))\">\r\n",
"##INFO=<ID=ABHom,Number=1,Type=Float,Description=\"Allele Balance for homs (A/(A+O))\">\r\n",
"##INFO=<ID=AC,Number=A,Type=Integer,Description=\"Allele count in genotypes, for each ALT allele, in the same order as listed\">\r\n",
"##INFO=<ID=AF,Number=A,Type=Float,Description=\"Allele Frequency, for each ALT allele, in the same order as listed\">\r\n",
"##INFO=<ID=AN,Number=1,Type=Integer,Description=\"Total number of alleles in called genotypes\">\r\n",
"##INFO=<ID=BaseQRankSum,Number=1,Type=Float,Description=\"Z-score from Wilcoxon rank sum test of Alt Vs. Ref base qualities\">\r\n",
"##INFO=<ID=DB,Number=0,Type=Flag,Description=\"dbSNP Membership\">\r\n",
"##INFO=<ID=DP,Number=1,Type=Integer,Description=\"Approximate read depth; some reads may have been filtered\">\r\n",
"##INFO=<ID=DS,Number=0,Type=Flag,Description=\"Were any of the samples downsampled?\">\r\n",
"##INFO=<ID=Dels,Number=1,Type=Float,Description=\"Fraction of Reads Containing Spanning Deletions\">\r\n",
"##INFO=<ID=END,Number=1,Type=Integer,Description=\"Stop position of the interval\">\r\n",
"##INFO=<ID=FS,Number=1,Type=Float,Description=\"Phred-scaled p-value using Fisher's exact test to detect strand bias\">\r\n",
"##INFO=<ID=HaplotypeScore,Number=1,Type=Float,Description=\"Consistency of the site with at most two segregating haplotypes\">\r\n",
"##INFO=<ID=InbreedingCoeff,Number=1,Type=Float,Description=\"Inbreeding coefficient as estimated from the genotype likelihoods per-sample when compared against the Hardy-Weinberg expectation\">\r\n",
"##INFO=<ID=MLEAC,Number=A,Type=Integer,Description=\"Maximum likelihood expectation (MLE) for the allele counts (not necessarily the same as the AC), for each ALT allele, in the same order as listed\">\r\n",
"##INFO=<ID=MLEAF,Number=A,Type=Float,Description=\"Maximum likelihood expectation (MLE) for the allele frequency (not necessarily the same as the AF), for each ALT allele, in the same order as listed\">\r\n",
"##INFO=<ID=MQ,Number=1,Type=Float,Description=\"RMS Mapping Quality\">\r\n",
"##INFO=<ID=MQ0,Number=1,Type=Integer,Description=\"Total Mapping Quality Zero Reads\">\r\n",
"##INFO=<ID=MQRankSum,Number=1,Type=Float,Description=\"Z-score From Wilcoxon rank sum test of Alt vs. Ref read mapping qualities\">\r\n",
"##INFO=<ID=OND,Number=1,Type=Float,Description=\"Overall non-diploid ratio (alleles/(alleles+non-alleles))\">\r\n",
"##INFO=<ID=QD,Number=1,Type=Float,Description=\"Variant Confidence/Quality by Depth\">\r\n",
"##INFO=<ID=RPA,Number=.,Type=Integer,Description=\"Number of times tandem repeat unit is repeated, for each allele (including reference)\">\r\n",
"##INFO=<ID=RU,Number=1,Type=String,Description=\"Tandem repeat unit (bases)\">\r\n",
"##INFO=<ID=ReadPosRankSum,Number=1,Type=Float,Description=\"Z-score from Wilcoxon rank sum test of Alt vs. Ref read position bias\">\r\n",
"##INFO=<ID=SB,Number=1,Type=Float,Description=\"Strand Bias\">\r\n",
"##INFO=<ID=STR,Number=0,Type=Flag,Description=\"Variant is a short tandem repeat\">\r\n",
"##INFO=<ID=VQSLOD,Number=1,Type=Float,Description=\"Log odds ratio of being a true variant versus being false under the trained gaussian mixture model\">\r\n",
"##INFO=<ID=culprit,Number=1,Type=String,Description=\"The annotation which was the worst performing in the Gaussian mixture model, likely the reason why the variant was filtered out\">\r\n",
"##INFO=<ID=set,Number=1,Type=String,Description=\"Source VCF for the merged record in CombineVariants\">\r\n",
"##SelectVariants=\"analysis_type=SelectVariants input_file=[] read_buffer_size=null phone_home=STANDARD gatk_key=null read_filter=[] intervals=null excludeIntervals=null interval_set_rule=UNION interval_merging=ALL interval_padding=0 reference_sequence=/tmp/generate_SELECTEDVARIANTS.py/3aed2f246e8c0249ff8a031bd209dc10/human_g1k_v37.fasta nonDeterministicRandomSeed=false downsampling_type=BY_SAMPLE downsample_to_fraction=null downsample_to_coverage=1000 baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false BQSR=null quantize_quals=0 disable_indel_quals=false emit_original_quals=false preserve_qscores_less_than=6 defaultBaseQualities=-1 validation_strictness=SILENT remove_program_records=false keep_program_records=false unsafe=null num_threads=1 num_cpu_threads=null num_io_threads=null num_bam_file_handles=null read_group_black_list=null pedigree=[] pedigreeString=[] pedigreeValidationType=STRICT allow_intervals_with_unindexed_bam=false generateShadowBCF=false logging_level=INFO log_to_file=null help=false variant=(RodBinding name=variant source=/tmp/generate_SELECTEDVARIANTS.py/3aed2f246e8c0249ff8a031bd209dc10/ISDB11122.variants.raw.vcf) discordance=(RodBinding name= source=UNBOUND) concordance=(RodBinding name= source=UNBOUND) out=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub no_cmdline_in_header=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub bcf=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub sample_name=[] sample_expressions=null sample_file=null exclude_sample_name=[] exclude_sample_file=[] select_expressions=[] excludeNonVariants=false excludeFiltered=false regenotype=false restrictAllelesTo=ALL keepOriginalAC=false mendelianViolation=false mendelianViolationQualThreshold=0.0 select_random_number=0 select_random_fraction=0.0 remove_fraction_genotypes=0.0 selectTypeToInclude=[SNP] keepIDs=null fullyDecode=false forceGenotypesDecode=false justRead=false filter_mismatching_base_and_quals=false\"\r\n",
"##UnifiedGenotyper=\"analysis_type=UnifiedGenotyper input_file=[/storage/gluster/insilico/data/GenomicsData/ISDBM32/ISDBM322016/printreads/880ddadd1566253466a7e6761e854445/ISDBM322016.recal.bam, /storage/gluster/insilico/data/GenomicsData/ISDBM32/ISDBM322018/printreads/c3a712cdc76c431297effdb013de7bd2/ISDBM322018.recal.bam, /storage/gluster/insilico/data/GenomicsData/ISDBM32/ISDBM322017/printreads/b43e7abc909888a6a066fc3da4c305e7/ISDBM322017.recal.bam, /storage/gluster/insilico/data/GenomicsData/ISDBM32/ISDBM322015/printreads/8eb77fc396f7325f7da846402d1a6df9/ISDBM322015.recal.bam] read_buffer_size=null phone_home=STANDARD gatk_key=null read_filter=[] intervals=null excludeIntervals=null interval_set_rule=UNION interval_merging=ALL interval_padding=0 reference_sequence=/tmp/generate_UNIFIEDGENOTYPER.py/dbe01e32e5f0143c1e3d62bfa4a46bd0/human_g1k_v37.fasta nonDeterministicRandomSeed=false downsampling_type=BY_SAMPLE downsample_to_fraction=null downsample_to_coverage=250 baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false BQSR=null quantize_quals=0 disable_indel_quals=false emit_original_quals=false preserve_qscores_less_than=6 defaultBaseQualities=-1 validation_strictness=SILENT remove_program_records=false keep_program_records=false unsafe=null num_threads=6 num_cpu_threads=null num_io_threads=null num_bam_file_handles=null read_group_black_list=null pedigree=[] pedigreeString=[] pedigreeValidationType=STRICT allow_intervals_with_unindexed_bam=false generateShadowBCF=false logging_level=INFO log_to_file=null help=false genotype_likelihoods_model=BOTH p_nonref_model=EXACT pcr_error_rate=1.0E-4 noSLOD=false annotateNDA=false min_base_quality_score=17 max_deletion_fraction=0.05 cap_max_alternate_alleles_for_indels=false min_indel_count_for_genotyping=5 min_indel_fraction_per_sample=0.25 indel_heterozygosity=1.25E-4 indelGapContinuationPenalty=10 indelGapOpenPenalty=45 indelHaplotypeSize=80 noBandedIndel=false indelDebug=false ignoreSNPAlleles=false allReadsSP=false ignoreLaneInfo=false reference_sample_calls=(RodBinding name= source=UNBOUND) reference_sample_name=null sample_ploidy=2 min_quality_score=1 max_quality_score=40 site_quality_prior=20 min_power_threshold_for_calling=0.95 min_reference_depth=100 exclude_filtered_reference_sites=false heterozygosity=0.0010 genotyping_mode=DISCOVERY output_mode=EMIT_VARIANTS_ONLY standard_min_confidence_threshold_for_calling=30.0 standard_min_confidence_threshold_for_emitting=30.0 alleles=(RodBinding name= source=UNBOUND) max_alternate_alleles=3 dbsnp=(RodBinding name=dbsnp source=/tmp/generate_UNIFIEDGENOTYPER.py/dbe01e32e5f0143c1e3d62bfa4a46bd0/dbsnp_135.b37.vcf) comp=[] out=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub no_cmdline_in_header=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub bcf=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub debug_file=null metrics_file=null annotation=[AlleleBalance, DepthOfCoverage, FisherStrand] excludeAnnotation=[] filter_mismatching_base_and_quals=false\"\r\n",
"##VariantFiltration=\"analysis_type=VariantFiltration input_file=[] read_buffer_size=null phone_home=STANDARD gatk_key=null read_filter=[] intervals=null excludeIntervals=null interval_set_rule=UNION interval_merging=ALL interval_padding=0 reference_sequence=/tmp/generate_VARIANT_FILTRATION.py/af94a8015760f0c3d105ae21bdcee583/human_g1k_v37.fasta nonDeterministicRandomSeed=false downsampling_type=BY_SAMPLE downsample_to_fraction=null downsample_to_coverage=1000 baq=OFF baqGapOpenPenalty=40.0 performanceLog=null useOriginalQualities=false BQSR=null quantize_quals=0 disable_indel_quals=false emit_original_quals=false preserve_qscores_less_than=6 defaultBaseQualities=-1 validation_strictness=SILENT remove_program_records=false keep_program_records=false unsafe=null num_threads=1 num_cpu_threads=null num_io_threads=null num_bam_file_handles=null read_group_black_list=null pedigree=[] pedigreeString=[] pedigreeValidationType=STRICT allow_intervals_with_unindexed_bam=false generateShadowBCF=false logging_level=INFO log_to_file=/storage/gluster/insilico/data/GenomicsData/Series//ISDB11122GPL11154/variant_filtration/af94a8015760f0c3d105ae21bdcee583/ISDB11122.indel.filtered.vcf.log help=false variant=(RodBinding name=variant source=/tmp/generate_VARIANT_FILTRATION.py/af94a8015760f0c3d105ae21bdcee583/ISDB11122.indels.raw.vcf) mask=(RodBinding name= source=UNBOUND) out=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub no_cmdline_in_header=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub sites_only=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub bcf=org.broadinstitute.sting.gatk.io.stubs.VariantContextWriterStub filterExpression=[QD < 2.0 || ReadPosRankSum < -20.0 || FS > 200.0] filterName=[GATKStandard] genotypeFilterExpression=[] genotypeFilterName=[] clusterSize=3 clusterWindowSize=0 maskExtension=0 maskName=Mask missingValuesInExpressionsShouldEvaluateAsFailing=true invalidatePreviousFilters=false filter_mismatching_base_and_quals=false\"\r\n",
"##contig=<ID=1,length=249250621,assembly=b37>\r\n",
"##contig=<ID=2,length=243199373,assembly=b37>\r\n",
"##contig=<ID=3,length=198022430,assembly=b37>\r\n",
"##contig=<ID=4,length=191154276,assembly=b37>\r\n",
"##contig=<ID=5,length=180915260,assembly=b37>\r\n",
"##contig=<ID=6,length=171115067,assembly=b37>\r\n",
"##contig=<ID=7,length=159138663,assembly=b37>\r\n",
"##contig=<ID=8,length=146364022,assembly=b37>\r\n",
"##contig=<ID=9,length=141213431,assembly=b37>\r\n",
"##contig=<ID=10,length=135534747,assembly=b37>\r\n",
"##contig=<ID=11,length=135006516,assembly=b37>\r\n",
"##contig=<ID=12,length=133851895,assembly=b37>\r\n",
"##contig=<ID=13,length=115169878,assembly=b37>\r\n",
"##contig=<ID=14,length=107349540,assembly=b37>\r\n",
"##contig=<ID=15,length=102531392,assembly=b37>\r\n",
"##contig=<ID=16,length=90354753,assembly=b37>\r\n",
"##contig=<ID=17,length=81195210,assembly=b37>\r\n",
"##contig=<ID=18,length=78077248,assembly=b37>\r\n",
"##contig=<ID=19,length=59128983,assembly=b37>\r\n",
"##contig=<ID=20,length=63025520,assembly=b37>\r\n",
"##contig=<ID=21,length=48129895,assembly=b37>\r\n",
"##contig=<ID=22,length=51304566,assembly=b37>\r\n",
"##contig=<ID=X,length=155270560,assembly=b37>\r\n",
"##contig=<ID=Y,length=59373566,assembly=b37>\r\n",
"##contig=<ID=MT,length=16569,assembly=b37>\r\n",
"##contig=<ID=GL000207.1,length=4262,assembly=b37>\r\n",
"##contig=<ID=GL000226.1,length=15008,assembly=b37>\r\n",
"##contig=<ID=GL000229.1,length=19913,assembly=b37>\r\n",
"##contig=<ID=GL000231.1,length=27386,assembly=b37>\r\n",
"##contig=<ID=GL000210.1,length=27682,assembly=b37>\r\n",
"##contig=<ID=GL000239.1,length=33824,assembly=b37>\r\n",
"##contig=<ID=GL000235.1,length=34474,assembly=b37>\r\n",
"##contig=<ID=GL000201.1,length=36148,assembly=b37>\r\n",
"##contig=<ID=GL000247.1,length=36422,assembly=b37>\r\n",
"##contig=<ID=GL000245.1,length=36651,assembly=b37>\r\n",
"##contig=<ID=GL000197.1,length=37175,assembly=b37>\r\n",
"##contig=<ID=GL000203.1,length=37498,assembly=b37>\r\n",
"##contig=<ID=GL000246.1,length=38154,assembly=b37>\r\n",
"##contig=<ID=GL000249.1,length=38502,assembly=b37>\r\n",
"##contig=<ID=GL000196.1,length=38914,assembly=b37>\r\n",
"##contig=<ID=GL000248.1,length=39786,assembly=b37>\r\n",
"##contig=<ID=GL000244.1,length=39929,assembly=b37>\r\n",
"##contig=<ID=GL000238.1,length=39939,assembly=b37>\r\n",
"##contig=<ID=GL000202.1,length=40103,assembly=b37>\r\n",
"##contig=<ID=GL000234.1,length=40531,assembly=b37>\r\n",
"##contig=<ID=GL000232.1,length=40652,assembly=b37>\r\n",
"##contig=<ID=GL000206.1,length=41001,assembly=b37>\r\n",
"##contig=<ID=GL000240.1,length=41933,assembly=b37>\r\n",
"##contig=<ID=GL000236.1,length=41934,assembly=b37>\r\n",
"##contig=<ID=GL000241.1,length=42152,assembly=b37>\r\n",
"##contig=<ID=GL000243.1,length=43341,assembly=b37>\r\n",
"##contig=<ID=GL000242.1,length=43523,assembly=b37>\r\n",
"##contig=<ID=GL000230.1,length=43691,assembly=b37>\r\n",
"##contig=<ID=GL000237.1,length=45867,assembly=b37>\r\n",
"##contig=<ID=GL000233.1,length=45941,assembly=b37>\r\n",
"##contig=<ID=GL000204.1,length=81310,assembly=b37>\r\n",
"##contig=<ID=GL000198.1,length=90085,assembly=b37>\r\n",
"##contig=<ID=GL000208.1,length=92689,assembly=b37>\r\n",
"##contig=<ID=GL000191.1,length=106433,assembly=b37>\r\n",
"##contig=<ID=GL000227.1,length=128374,assembly=b37>\r\n",
"##contig=<ID=GL000228.1,length=129120,assembly=b37>\r\n",
"##contig=<ID=GL000214.1,length=137718,assembly=b37>\r\n",
"##contig=<ID=GL000221.1,length=155397,assembly=b37>\r\n",
"##contig=<ID=GL000209.1,length=159169,assembly=b37>\r\n",
"##contig=<ID=GL000218.1,length=161147,assembly=b37>\r\n",
"##contig=<ID=GL000220.1,length=161802,assembly=b37>\r\n",
"##contig=<ID=GL000213.1,length=164239,assembly=b37>\r\n",
"##contig=<ID=GL000211.1,length=166566,assembly=b37>\r\n",
"##contig=<ID=GL000199.1,length=169874,assembly=b37>\r\n",
"##contig=<ID=GL000217.1,length=172149,assembly=b37>\r\n",
"##contig=<ID=GL000216.1,length=172294,assembly=b37>\r\n",
"##contig=<ID=GL000215.1,length=172545,assembly=b37>\r\n",
"##contig=<ID=GL000205.1,length=174588,assembly=b37>\r\n",
"##contig=<ID=GL000219.1,length=179198,assembly=b37>\r\n",
"##contig=<ID=GL000224.1,length=179693,assembly=b37>\r\n",
"##contig=<ID=GL000223.1,length=180455,assembly=b37>\r\n",
"##contig=<ID=GL000195.1,length=182896,assembly=b37>\r\n",
"##contig=<ID=GL000212.1,length=186858,assembly=b37>\r\n",
"##contig=<ID=GL000222.1,length=186861,assembly=b37>\r\n",
"##contig=<ID=GL000200.1,length=187035,assembly=b37>\r\n",
"##contig=<ID=GL000193.1,length=189789,assembly=b37>\r\n",
"##contig=<ID=GL000194.1,length=191469,assembly=b37>\r\n",
"##contig=<ID=GL000225.1,length=211173,assembly=b37>\r\n",
"##contig=<ID=GL000192.1,length=547496,assembly=b37>\r\n",
"##reference=file:///tmp/generate_COMBINE_VARIANTS.py/00e90c599e331929a09028693bed91f7/human_g1k_v37.fasta\r\n",
"##source=SelectVariants\r\n",
"##SnpEffVersion=\"3.3c (build 2013-06-28), by Pablo Cingolani\"\r\n",
"##SnpEffCmd=\"SnpEff -t hg19 /tmp/generate_SNPEFF.py/98b17a7321fce5a67e5dcd5a1c24a311/ISDB11122.SNPrecal.IndelFiltered.vcf \"\r\n",
"##INFO=<ID=EFF,Number=.,Type=String,Description=\"Predicted effects for this variant.Format: 'Effect ( Effect_Impact | Functional_Class | Codon_Change | Amino_Acid_change| Amino_Acid_length | Gene_Name | Transcript_BioType | Gene_Coding | Transcript_ID | Exon | GenotypeNum [ | ERRORS | WARNINGS ] )' \">\r\n",
"#CHROM\tPOS\tID\tREF\tALT\tQUAL\tFILTER\tINFO\tFORMAT\tISDBM322015\tISDBM322016\tISDBM322017\tISDBM322018\r\n"
]
}
],
"source": [
"!head -n 135 Pfeiffer-quartet.vcf"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"데이터 로드하기. 135줄부터 로드해야 함."
]
},
{
"cell_type": "code",
"execution_count": 3,
"metadata": {
"collapsed": false,
"scrolled": true
},
"outputs": [
{
"data": {
"text/html": [
"<div>\n",
"<table border=\"1\" class=\"dataframe\">\n",
" <thead>\n",
" <tr style=\"text-align: right;\">\n",
" <th></th>\n",
" <th>#CHROM</th>\n",
" <th>POS</th>\n",
" <th>ID</th>\n",
" <th>REF</th>\n",
" <th>ALT</th>\n",
" <th>QUAL</th>\n",
" <th>FILTER</th>\n",
" <th>INFO</th>\n",
" <th>FORMAT</th>\n",
" <th>ISDBM322015</th>\n",
" <th>ISDBM322016</th>\n",
" <th>ISDBM322017</th>\n",
" <th>ISDBM322018</th>\n",
" </tr>\n",
" </thead>\n",
" <tbody>\n",
" <tr>\n",
" <th>0</th>\n",
" <td>1</td>\n",
" <td>14907</td>\n",
" <td>rs79585140</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>514.87</td>\n",
" <td>VQSRTrancheSNP99.00to99.90</td>\n",
" <td>ABHet=0.628;ABHom=1.00;AC=3;AF=0.375;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:6,0:6:18:0,18,178</td>\n",
" <td>0/1:17,10:27:99:208,0,341</td>\n",
" <td>0/1:14,9:23:99:176,0,258</td>\n",
" <td>0/1:20,11:31:99:174,0,380</td>\n",
" </tr>\n",
" <tr>\n",
" <th>1</th>\n",
" <td>1</td>\n",
" <td>14930</td>\n",
" <td>rs75454623</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>780.25</td>\n",
" <td>VQSRTrancheSNP99.00to99.90</td>\n",
" <td>ABHet=0.644;AC=4;AF=0.500;AN=8;BaseQRankSum=-5...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:6,1:7:7:7,0,150</td>\n",
" <td>0/1:16,13:29:99:296,0,378</td>\n",
" <td>0/1:19,13:32:99:245,0,420</td>\n",
" <td>0/1:24,15:39:99:274,0,535</td>\n",
" </tr>\n",
" <tr>\n",
" <th>2</th>\n",
" <td>1</td>\n",
" <td>14948</td>\n",
" <td>.</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>47.48</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.846;ABHom=1.00;AC=2;AF=0.250;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:10,0:10:24:0,24,228</td>\n",
" <td>0/0:32,0:32:81:0,81,734</td>\n",
" <td>0/1:28,6:34:79:79,0,549</td>\n",
" <td>0/1:41,6:47:8:8,0,850</td>\n",
" </tr>\n",
" <tr>\n",
" <th>3</th>\n",
" <td>1</td>\n",
" <td>15211</td>\n",
" <td>rs144718396</td>\n",
" <td>T</td>\n",
" <td>G</td>\n",
" <td>110.28</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.359;ABHom=1.00;AC=5;AF=0.625;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:1,1:2:17:17,0,17</td>\n",
" <td>0/1:3,5:8:8:76,0,8</td>\n",
" <td>1/1:0,1:1:3:23,3,0</td>\n",
" <td>0/1:1,4:5:14:36,0,14</td>\n",
" </tr>\n",
" <tr>\n",
" <th>4</th>\n",
" <td>1</td>\n",
" <td>17538</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>A</td>\n",
" <td>151.64</td>\n",
" <td>VQSRTrancheSNP99.00to99.90</td>\n",
" <td>ABHet=0.735;ABHom=1.00;AC=2;AF=0.250;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:2,0:2:6:0,6,80</td>\n",
" <td>0/1:10,2:13:51:51,0,138</td>\n",
" <td>0/0:23,1:24:0:0,0,418</td>\n",
" <td>0/1:14,8:22:99:139,0,243</td>\n",
" </tr>\n",
" <tr>\n",
" <th>5</th>\n",
" <td>1</td>\n",
" <td>63336</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>T</td>\n",
" <td>460.26</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.705;ABHom=1.00;AC=2;AF=0.333;AN=6;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>0/1:31,15:46:99:340,0,308</td>\n",
" <td>0/1:25,9:34:99:159,0,394</td>\n",
" <td>0/0:52,0:52:90:0,90,830</td>\n",
" </tr>\n",
" <tr>\n",
" <th>6</th>\n",
" <td>1</td>\n",
" <td>63735</td>\n",
" <td>.</td>\n",
" <td>CCTA</td>\n",
" <td>C</td>\n",
" <td>193.23</td>\n",
" <td>PASS</td>\n",
" <td>AC=3;AF=0.500;AN=6;BaseQRankSum=-0.960;DP=42;F...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:6,2:4:6:116,6,0</td>\n",
" <td>0/1:8,4:8:99:128,0,301</td>\n",
" <td>0/0:18,2:15:30:0,30,666</td>\n",
" </tr>\n",
" <tr>\n",
" <th>7</th>\n",
" <td>1</td>\n",
" <td>69511</td>\n",
" <td>rs75062661</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>4293.01</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHom=0.982;AC=8;AF=1.00;AN=8;BaseQRankSum=2.0...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:2,171:173:99:2218,228,0</td>\n",
" <td>1/1:0,33:34:60:508,60,0</td>\n",
" <td>1/1:0,61:63:93:777,93,0</td>\n",
" <td>1/1:0,61:61:96:790,96,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>8</th>\n",
" <td>1</td>\n",
" <td>121009</td>\n",
" <td>rs1851943</td>\n",
" <td>C</td>\n",
" <td>T</td>\n",
" <td>35.27</td>\n",
" <td>VQSRTrancheSNP99.00to99.90</td>\n",
" <td>ABHet=0.636;ABHom=0.929;AC=1;AF=0.167;AN=6;Bas...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>0/0:11,0:11:33:0,33,436</td>\n",
" <td>0/0:6,1:7:18:0,18,240</td>\n",
" <td>0/1:7,4:11:70:70,0,229</td>\n",
" </tr>\n",
" <tr>\n",
" <th>9</th>\n",
" <td>1</td>\n",
" <td>133160</td>\n",
" <td>.</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>88.69</td>\n",
" <td>VQSRTrancheSNP99.00to99.90</td>\n",
" <td>ABHet=0.750;ABHom=0.841;AC=3;AF=0.500;AN=6;Bas...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:1,3:4:9:109,9,0</td>\n",
" <td>0/1:3,1:4:20:20,0,107</td>\n",
" <td>./.</td>\n",
" <td>0/0:1,0:1:3:0,3,40</td>\n",
" </tr>\n",
" <tr>\n",
" <th>10</th>\n",
" <td>1</td>\n",
" <td>546952</td>\n",
" <td>rs9438487</td>\n",
" <td>T</td>\n",
" <td>C</td>\n",
" <td>43.22</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHom=1.00;AC=4;AF=1.00;AN=4;DB;DP=3;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,2:2:6:49,6,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,1:1:3:28,3,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>11</th>\n",
" <td>1</td>\n",
" <td>745347</td>\n",
" <td>.</td>\n",
" <td>T</td>\n",
" <td>C</td>\n",
" <td>59.16</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.702;ABHom=0.938;AC=3;AF=0.375;AN=8;Bas...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:3,1:4:13:13,0,60</td>\n",
" <td>0/0:15,1:16:8:0,8,212</td>\n",
" <td>0/1:4,4:8:71:75,0,71</td>\n",
" <td>0/1:13,2:15:13:13,0,203</td>\n",
" </tr>\n",
" <tr>\n",
" <th>12</th>\n",
" <td>1</td>\n",
" <td>745370</td>\n",
" <td>rs146246821</td>\n",
" <td>TA</td>\n",
" <td>T</td>\n",
" <td>510.54</td>\n",
" <td>PASS</td>\n",
" <td>AC=4;AF=0.500;AN=8;BaseQRankSum=1.905;DB;DP=64...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:4,1:5:32:32,0,185</td>\n",
" <td>0/1:17,4:18:99:132,0,623</td>\n",
" <td>0/1:9,7:16:99:273,0,395</td>\n",
" <td>0/1:16,4:19:99:125,0,661</td>\n",
" </tr>\n",
" <tr>\n",
" <th>13</th>\n",
" <td>1</td>\n",
" <td>752566</td>\n",
" <td>rs3094315</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>118.67</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=6;AF=1.00;AN=6;DB;DP=4;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,2:2:6:79,6,0</td>\n",
" <td>1/1:0,1:1:3:39,3,0</td>\n",
" <td>1/1:0,1:1:3:36,3,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>14</th>\n",
" <td>1</td>\n",
" <td>752721</td>\n",
" <td>rs3131972</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>242.70</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=6;AF=1.00;AN=6;DB;DP=7;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,2:2:6:80,6,0</td>\n",
" <td>1/1:0,4:4:12:159,12,0</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>15</th>\n",
" <td>1</td>\n",
" <td>753405</td>\n",
" <td>rs61770173</td>\n",
" <td>C</td>\n",
" <td>A</td>\n",
" <td>432.40</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHom=1.00;AC=6;AF=1.00;AN=6;DB;DP=31;Dels=0.0...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,14:14:24:221,24,0</td>\n",
" <td>1/1:0,8:8:12:111,12,0</td>\n",
" <td>1/1:0,9:9:15:138,15,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>16</th>\n",
" <td>1</td>\n",
" <td>753474</td>\n",
" <td>rs2073814</td>\n",
" <td>C</td>\n",
" <td>G</td>\n",
" <td>271.92</td>\n",
" <td>VQSRTrancheSNP99.00to99.90</td>\n",
" <td>ABHom=0.952;AC=6;AF=1.00;AN=6;DB;DP=15;Dels=0....</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,3:3:9:118,9,0</td>\n",
" <td>1/1:0,6:7:9:83,9,0</td>\n",
" <td>1/1:0,5:5:9:108,9,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>17</th>\n",
" <td>1</td>\n",
" <td>758324</td>\n",
" <td>rs3131955</td>\n",
" <td>T</td>\n",
" <td>C</td>\n",
" <td>45.77</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=2;AF=1.00;AN=2;DB;DP=2;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,2:2:6:77,6,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" </tr>\n",
" <tr>\n",
" <th>18</th>\n",
" <td>1</td>\n",
" <td>780027</td>\n",
" <td>rs2977613</td>\n",
" <td>G</td>\n",
" <td>T</td>\n",
" <td>47.01</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=4;AF=1.00;AN=4;DB;DP=2;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" <td>./.</td>\n",
" </tr>\n",
" <tr>\n",
" <th>19</th>\n",
" <td>1</td>\n",
" <td>808631</td>\n",
" <td>rs11240779</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>1853.99</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.000;AC=8;AF=1.00;AN=8;DB;DP=52;Dels=0....</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,7:7:21:223,21,0</td>\n",
" <td>1/1:0,16:16:48:602,48,0</td>\n",
" <td>1/1:0,13:13:36:457,36,0</td>\n",
" <td>1/1:0,16:16:48:611,48,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>20</th>\n",
" <td>1</td>\n",
" <td>808922</td>\n",
" <td>rs6594027</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>4960.01</td>\n",
" <td>VQSRTrancheSNP99.00to99.90</td>\n",
" <td>ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=222;Dels=0....</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,43:43:96:1199,96,0</td>\n",
" <td>1/1:0,62:62:99:1304,102,0</td>\n",
" <td>1/1:0,58:58:93:1169,93,0</td>\n",
" <td>1/1:0,59:59:99:1288,102,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>21</th>\n",
" <td>1</td>\n",
" <td>808928</td>\n",
" <td>rs11240780</td>\n",
" <td>C</td>\n",
" <td>T</td>\n",
" <td>5605.01</td>\n",
" <td>VQSRTrancheSNP99.00to99.90</td>\n",
" <td>ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=234;Dels=0....</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,48:48:99:1318,111,0</td>\n",
" <td>1/1:0,61:61:99:1456,114,0</td>\n",
" <td>1/1:0,63:63:99:1383,111,0</td>\n",
" <td>1/1:0,62:62:99:1448,114,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>22</th>\n",
" <td>1</td>\n",
" <td>809171</td>\n",
" <td>.</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>103.55</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.800;ABHom=0.936;AC=2;AF=0.250;AN=8;Bas...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:35,6:41:36:36,0,520</td>\n",
" <td>0/1:44,15:59:99:109,0,657</td>\n",
" <td>0/0:47,5:52:57:0,57,722</td>\n",
" <td>0/0:31,0:32:78:0,78,634</td>\n",
" </tr>\n",
" <tr>\n",
" <th>23</th>\n",
" <td>1</td>\n",
" <td>809732</td>\n",
" <td>rs147199422</td>\n",
" <td>T</td>\n",
" <td>C</td>\n",
" <td>44.02</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.865;ABHom=0.932;AC=1;AF=0.125;AN=8;Bas...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:64,10:74:80:80,0,2123</td>\n",
" <td>0/0:58,2:60:99:0,121,2171</td>\n",
" <td>0/0:42,4:46:17:0,17,1486</td>\n",
" <td>0/0:54,5:59:29:0,29,1912</td>\n",
" </tr>\n",
" <tr>\n",
" <th>24</th>\n",
" <td>1</td>\n",
" <td>809744</td>\n",
" <td>.</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>40.99</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.864;ABHom=0.950;AC=1;AF=0.125;AN=8;Bas...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:57,9:67:77:77,0,1851</td>\n",
" <td>0/0:57,2:60:99:0,115,2057</td>\n",
" <td>0/0:46,3:49:59:0,59,1686</td>\n",
" <td>0/0:53,3:56:74:0,74,1828</td>\n",
" </tr>\n",
" <tr>\n",
" <th>25</th>\n",
" <td>1</td>\n",
" <td>812267</td>\n",
" <td>rs7541694</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>385.67</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=13;Dels=0.0...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,3:3:9:95,9,0</td>\n",
" <td>1/1:0,5:5:15:175,15,0</td>\n",
" <td>1/1:0,2:2:6:55,6,0</td>\n",
" <td>1/1:0,3:3:9:99,9,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>26</th>\n",
" <td>1</td>\n",
" <td>812284</td>\n",
" <td>rs7545373</td>\n",
" <td>C</td>\n",
" <td>G</td>\n",
" <td>428.75</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=13;Dels=0.0...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,5:5:15:185,15,0</td>\n",
" <td>1/1:0,4:4:12:148,12,0</td>\n",
" <td>1/1:0,2:2:6:55,6,0</td>\n",
" <td>1/1:0,2:2:6:79,6,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>27</th>\n",
" <td>1</td>\n",
" <td>823790</td>\n",
" <td>rs143626389</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>38.82</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=2;AF=0.500;AN=4;BaseQRankSum=0.3...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,2:2:6:75,6,0</td>\n",
" <td>./.</td>\n",
" <td>0/0:3,0:3:9:0,9,99</td>\n",
" </tr>\n",
" <tr>\n",
" <th>28</th>\n",
" <td>1</td>\n",
" <td>834832</td>\n",
" <td>rs4411087</td>\n",
" <td>G</td>\n",
" <td>C</td>\n",
" <td>48.77</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=2;AF=1.00;AN=2;DB;DP=2;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,2:2:6:80,6,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" </tr>\n",
" <tr>\n",
" <th>29</th>\n",
" <td>1</td>\n",
" <td>849998</td>\n",
" <td>rs13303222</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>45.77</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=2;AF=1.00;AN=2;DB;DP=2;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,2:2:6:77,6,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" </tr>\n",
" <tr>\n",
" <th>...</th>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300006</th>\n",
" <td>GL000225.1</td>\n",
" <td>198637</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>T</td>\n",
" <td>80.98</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=2;AF=1.00;AN=2;DP=3;Dels=0.00;FS...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,3:3:9:113,9,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300007</th>\n",
" <td>GL000225.1</td>\n",
" <td>198643</td>\n",
" <td>.</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>86.98</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=2;AF=1.00;AN=2;DP=3;Dels=0.00;FS...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,3:3:9:119,9,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300008</th>\n",
" <td>GL000225.1</td>\n",
" <td>202533</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>T</td>\n",
" <td>46.77</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=2;AF=1.00;AN=2;DP=2;Dels=0.00;FS...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,2:2:6:78,6,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300009</th>\n",
" <td>GL000225.1</td>\n",
" <td>203673</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>T</td>\n",
" <td>78.22</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=4;AF=1.00;AN=4;DP=3;Dels=0.00;FS...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,2:2:6:80,6,0</td>\n",
" <td>1/1:0,1:1:3:32,3,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300010</th>\n",
" <td>GL000192.1</td>\n",
" <td>99120</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>T</td>\n",
" <td>1132.79</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.594;ABHom=1.00;AC=3;AF=0.375;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:37,35:72:99:680,0,597</td>\n",
" <td>0/1:30,11:41:99:211,0,460</td>\n",
" <td>0/1:15,13:28:99:285,0,257</td>\n",
" <td>0/0:45,0:45:99:0,123,1131</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300011</th>\n",
" <td>GL000192.1</td>\n",
" <td>99283</td>\n",
" <td>.</td>\n",
" <td>T</td>\n",
" <td>C</td>\n",
" <td>775.57</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.648;ABHom=0.800;AC=5;AF=0.625;AN=8;Bas...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:21,12:33:99:143,0,226</td>\n",
" <td>0/1:13,12:25:99:223,0,167</td>\n",
" <td>0/1:26,7:33:99:127,0,155</td>\n",
" <td>1/1:4,16:20:36:328,36,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300012</th>\n",
" <td>GL000192.1</td>\n",
" <td>99390</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>G</td>\n",
" <td>74.63</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.527;ABHom=1.00;AC=2;AF=0.250;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:3,0:3:6:0,6,55</td>\n",
" <td>0/0:7,0:7:12:0,12,111</td>\n",
" <td>0/1:5,4:9:13:96,0,13</td>\n",
" <td>0/1:5,5:10:19:19,0,46</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300013</th>\n",
" <td>GL000192.1</td>\n",
" <td>100085</td>\n",
" <td>.</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>128.56</td>\n",
" <td>VQSRTrancheSNP99.00to99.90</td>\n",
" <td>ABHet=0.442;ABHom=1.00;AC=4;AF=0.667;AN=6;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>0/1:2,1:3:19:19,0,66</td>\n",
" <td>0/1:1,4:5:11:120,0,11</td>\n",
" <td>1/1:0,1:1:3:28,3,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300014</th>\n",
" <td>GL000192.1</td>\n",
" <td>101228</td>\n",
" <td>.</td>\n",
" <td>T</td>\n",
" <td>C</td>\n",
" <td>493.56</td>\n",
" <td>VQSRTrancheSNP99.00to99.90</td>\n",
" <td>ABHet=0.378;ABHom=1.00;AC=5;AF=0.625;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:6,3:9:93:93,0,186</td>\n",
" <td>0/1:3,7:10:75:222,0,75</td>\n",
" <td>0/1:1,5:6:23:133,0,23</td>\n",
" <td>1/1:0,3:3:9:90,9,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300015</th>\n",
" <td>GL000192.1</td>\n",
" <td>101317</td>\n",
" <td>.</td>\n",
" <td>A</td>\n",
" <td>C</td>\n",
" <td>311.87</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.429;ABHom=1.00;AC=3;AF=0.375;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:10,7:17:99:146,0,201</td>\n",
" <td>0/1:3,7:10:28:166,0,28</td>\n",
" <td>0/0:7,0:7:18:0,18,166</td>\n",
" <td>0/1:2,3:5:43:43,0,43</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300016</th>\n",
" <td>GL000192.1</td>\n",
" <td>107709</td>\n",
" <td>.</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>149.56</td>\n",
" <td>VQSRTrancheSNP99.00to99.90</td>\n",
" <td>ABHet=0.662;ABHom=1.00;AC=2;AF=0.250;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:24,0:24:45:0,45,511</td>\n",
" <td>0/0:12,0:12:27:0,27,328</td>\n",
" <td>0/1:6,5:12:99:124,0,131</td>\n",
" <td>0/1:14,4:18:67:67,0,313</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300017</th>\n",
" <td>GL000192.1</td>\n",
" <td>111042</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>A</td>\n",
" <td>440.55</td>\n",
" <td>VQSRTrancheSNP99.00to99.90</td>\n",
" <td>ABHet=0.460;ABHom=1.00;AC=2;AF=0.250;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:39,0:39:78:0,78,1000</td>\n",
" <td>0/0:24,0:24:45:0,45,579</td>\n",
" <td>0/1:9,11:20:45:310,0,45</td>\n",
" <td>0/1:8,9:17:99:172,0,133</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300018</th>\n",
" <td>GL000192.1</td>\n",
" <td>121717</td>\n",
" <td>.</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>286.55</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.663;ABHom=1.00;AC=2;AF=0.250;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:45,0:45:51:0,51,470</td>\n",
" <td>0/0:29,0:29:51:0,51,463</td>\n",
" <td>0/1:20,7:27:87:87,0,281</td>\n",
" <td>0/1:17,12:29:99:241,0,209</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300019</th>\n",
" <td>GL000192.1</td>\n",
" <td>121977</td>\n",
" <td>.</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>1200.79</td>\n",
" <td>VQSRTrancheSNP99.00to99.90</td>\n",
" <td>ABHet=0.450;ABHom=1.00;AC=3;AF=0.375;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:19,19:38:99:492,0,361</td>\n",
" <td>0/1:16,15:31:99:394,0,386</td>\n",
" <td>0/0:28,0:28:84:0,84,918</td>\n",
" <td>0/1:6,12:18:99:358,0,137</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300020</th>\n",
" <td>GL000192.1</td>\n",
" <td>131599</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>G</td>\n",
" <td>360.79</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.460;ABHom=1.00;AC=3;AF=0.375;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:3,3:6:65:65,0,65</td>\n",
" <td>0/1:10,9:19:99:155,0,125</td>\n",
" <td>0/0:15,0:15:36:0,36,332</td>\n",
" <td>0/1:6,11:17:75:184,0,75</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300021</th>\n",
" <td>GL000192.1</td>\n",
" <td>139953</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>G</td>\n",
" <td>165.56</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.451;ABHom=1.00;AC=2;AF=0.250;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:27,0:27:57:0,57,725</td>\n",
" <td>0/0:18,0:18:30:0,30,363</td>\n",
" <td>0/1:11,4:15:48:48,0,280</td>\n",
" <td>0/1:1,5:6:21:159,0,21</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300022</th>\n",
" <td>GL000192.1</td>\n",
" <td>139953</td>\n",
" <td>.</td>\n",
" <td>CTG</td>\n",
" <td>C</td>\n",
" <td>1104.53</td>\n",
" <td>PASS</td>\n",
" <td>AC=4;AF=0.500;AN=8;BaseQRankSum=-3.358;DP=66;F...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:7,18:20:51:677,51,0</td>\n",
" <td>0/1:9,6:10:33:204,0,33</td>\n",
" <td>0/1:8,7:10:19:280,0,19</td>\n",
" <td>0/0:6,0:6:9:0,9,141</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300023</th>\n",
" <td>GL000192.1</td>\n",
" <td>160087</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>T</td>\n",
" <td>157.22</td>\n",
" <td>PASS</td>\n",
" <td>ABHet=0.625;ABHom=1.00;AC=6;AF=0.750;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:2,2:4:52:60,0,52</td>\n",
" <td>0/1:3,1:4:25:25,0,105</td>\n",
" <td>1/1:0,2:2:6:78,6,0</td>\n",
" <td>1/1:0,1:1:3:37,3,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300024</th>\n",
" <td>GL000192.1</td>\n",
" <td>197562</td>\n",
" <td>.</td>\n",
" <td>T</td>\n",
" <td>C</td>\n",
" <td>158.55</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHom=1.00;AC=4;AF=1.00;AN=4;DP=7;Dels=0.00;FS...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,4:4:12:111,12,0</td>\n",
" <td>1/1:0,3:3:9:83,9,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300025</th>\n",
" <td>GL000192.1</td>\n",
" <td>212151</td>\n",
" <td>.</td>\n",
" <td>G</td>\n",
" <td>C</td>\n",
" <td>566.79</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.498;AC=4;AF=0.500;AN=8;BaseQRankSum=0....</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:18,23:41:99:291,0,208</td>\n",
" <td>0/1:6,12:18:99:253,0,114</td>\n",
" <td>0/1:7,4:11:62:62,0,90</td>\n",
" <td>0/1:11,1:12:1:1,0,194</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300026</th>\n",
" <td>GL000192.1</td>\n",
" <td>216599</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>A</td>\n",
" <td>223.55</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.492;ABHom=1.00;AC=2;AF=0.250;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:46,0:46:99:0,102,941</td>\n",
" <td>0/0:19,0:19:33:0,33,304</td>\n",
" <td>0/1:5,6:11:56:139,0,56</td>\n",
" <td>0/1:9,8:17:99:126,0,130</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300027</th>\n",
" <td>GL000192.1</td>\n",
" <td>228788</td>\n",
" <td>.</td>\n",
" <td>G</td>\n",
" <td>T</td>\n",
" <td>46.77</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHom=0.500;AC=2;AF=1.00;AN=2;DP=10;Dels=0.00;...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:2,2:4:6:78,6,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300028</th>\n",
" <td>GL000192.1</td>\n",
" <td>229867</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>T</td>\n",
" <td>2232.98</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHom=0.857;AC=8;AF=1.00;AN=8;DP=111;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:4,25:29:66:609,66,0</td>\n",
" <td>1/1:2,25:27:57:528,57,0</td>\n",
" <td>1/1:6,23:29:66:609,66,0</td>\n",
" <td>1/1:4,22:26:57:526,57,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300029</th>\n",
" <td>GL000192.1</td>\n",
" <td>272061</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>CT</td>\n",
" <td>125.59</td>\n",
" <td>PASS</td>\n",
" <td>AC=3;AF=0.375;AN=8;BaseQRankSum=-0.058;DP=33;F...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:5,0:4:9:0,9,93</td>\n",
" <td>0/1:5,4:7:12:107,0,12</td>\n",
" <td>0/1:9,2:3:18:53,0,18</td>\n",
" <td>0/1:6,1:4:17:17,0,69</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300030</th>\n",
" <td>GL000192.1</td>\n",
" <td>311575</td>\n",
" <td>.</td>\n",
" <td>C</td>\n",
" <td>T</td>\n",
" <td>248.50</td>\n",
" <td>PASS</td>\n",
" <td>ABHet=0.333;ABHom=1.00;AC=3;AF=0.375;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:2,0:2:3:0,3,39</td>\n",
" <td>0/1:3,6:9:93:212,0,93</td>\n",
" <td>1/1:0,2:2:6:80,6,0</td>\n",
" <td>0/0:5,0:5:15:0,15,181</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300031</th>\n",
" <td>GL000192.1</td>\n",
" <td>313293</td>\n",
" <td>.</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>174.79</td>\n",
" <td>VQSRTrancheSNP99.90to100.00</td>\n",
" <td>ABHet=0.640;ABHom=1.00;AC=3;AF=0.375;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:42,16:58:55:55,0,587</td>\n",
" <td>0/0:34,0:34:42:0,42,447</td>\n",
" <td>0/1:26,10:36:57:57,0,367</td>\n",
" <td>0/1:19,21:40:99:106,0,367</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300032</th>\n",
" <td>GL000192.1</td>\n",
" <td>313701</td>\n",
" <td>.</td>\n",
" <td>T</td>\n",
" <td>C</td>\n",
" <td>120.67</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=6;AF=1.00;AN=6;DP=4;Dels=0.00;FS...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" <td>1/1:0,1:1:3:39,3,0</td>\n",
" <td>1/1:0,2:2:6:77,6,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300033</th>\n",
" <td>GL000192.1</td>\n",
" <td>337826</td>\n",
" <td>.</td>\n",
" <td>TA</td>\n",
" <td>T</td>\n",
" <td>489.51</td>\n",
" <td>PASS</td>\n",
" <td>AC=2;AF=0.250;AN=8;BaseQRankSum=-3.725;DP=62;F...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:18,0:18:51:0,51,855</td>\n",
" <td>0/0:13,0:13:39:0,39,695</td>\n",
" <td>0/1:5,10:15:99:438,0,228</td>\n",
" <td>0/1:13,3:16:99:102,0,647</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300034</th>\n",
" <td>GL000192.1</td>\n",
" <td>394140</td>\n",
" <td>.</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>45.26</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=2;AF=0.500;AN=4;BaseQRankSum=0.7...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>0/0:1,0:1:3:0,3,39</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,2:2:6:80,6,0</td>\n",
" </tr>\n",
" <tr>\n",
" <th>300035</th>\n",
" <td>10</td>\n",
" <td>123256215</td>\n",
" <td>.</td>\n",
" <td>T</td>\n",
" <td>G</td>\n",
" <td>100.00</td>\n",
" <td>PASS</td>\n",
" <td>GENE=FGFR2;INHERITANCE=AD;MIM=101600</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:1,0:1:3:0,3,39</td>\n",
" <td>0/0:1,0:1:3:0,3,39</td>\n",
" <td>1/0:1,0:1:3:0,3,39</td>\n",
" <td>0/0:1,0:1:3:0,3,39</td>\n",
" </tr>\n",
" </tbody>\n",
"</table>\n",
"<p>300036 rows × 13 columns</p>\n",
"</div>"
],
"text/plain": [
" #CHROM POS ID REF ALT QUAL \\\n",
"0 1 14907 rs79585140 A G 514.87 \n",
"1 1 14930 rs75454623 A G 780.25 \n",
"2 1 14948 . G A 47.48 \n",
"3 1 15211 rs144718396 T G 110.28 \n",
"4 1 17538 . C A 151.64 \n",
"5 1 63336 . C T 460.26 \n",
"6 1 63735 . CCTA C 193.23 \n",
"7 1 69511 rs75062661 A G 4293.01 \n",
"8 1 121009 rs1851943 C T 35.27 \n",
"9 1 133160 . G A 88.69 \n",
"10 1 546952 rs9438487 T C 43.22 \n",
"11 1 745347 . T C 59.16 \n",
"12 1 745370 rs146246821 TA T 510.54 \n",
"13 1 752566 rs3094315 G A 118.67 \n",
"14 1 752721 rs3131972 A G 242.70 \n",
"15 1 753405 rs61770173 C A 432.40 \n",
"16 1 753474 rs2073814 C G 271.92 \n",
"17 1 758324 rs3131955 T C 45.77 \n",
"18 1 780027 rs2977613 G T 47.01 \n",
"19 1 808631 rs11240779 G A 1853.99 \n",
"20 1 808922 rs6594027 G A 4960.01 \n",
"21 1 808928 rs11240780 C T 5605.01 \n",
"22 1 809171 . G A 103.55 \n",
"23 1 809732 rs147199422 T C 44.02 \n",
"24 1 809744 . A G 40.99 \n",
"25 1 812267 rs7541694 A G 385.67 \n",
"26 1 812284 rs7545373 C G 428.75 \n",
"27 1 823790 rs143626389 G A 38.82 \n",
"28 1 834832 rs4411087 G C 48.77 \n",
"29 1 849998 rs13303222 A G 45.77 \n",
"... ... ... ... ... .. ... \n",
"300006 GL000225.1 198637 . C T 80.98 \n",
"300007 GL000225.1 198643 . A G 86.98 \n",
"300008 GL000225.1 202533 . C T 46.77 \n",
"300009 GL000225.1 203673 . C T 78.22 \n",
"300010 GL000192.1 99120 . C T 1132.79 \n",
"300011 GL000192.1 99283 . T C 775.57 \n",
"300012 GL000192.1 99390 . C G 74.63 \n",
"300013 GL000192.1 100085 . A G 128.56 \n",
"300014 GL000192.1 101228 . T C 493.56 \n",
"300015 GL000192.1 101317 . A C 311.87 \n",
"300016 GL000192.1 107709 . G A 149.56 \n",
"300017 GL000192.1 111042 . C A 440.55 \n",
"300018 GL000192.1 121717 . G A 286.55 \n",
"300019 GL000192.1 121977 . G A 1200.79 \n",
"300020 GL000192.1 131599 . C G 360.79 \n",
"300021 GL000192.1 139953 . C G 165.56 \n",
"300022 GL000192.1 139953 . CTG C 1104.53 \n",
"300023 GL000192.1 160087 . C T 157.22 \n",
"300024 GL000192.1 197562 . T C 158.55 \n",
"300025 GL000192.1 212151 . G C 566.79 \n",
"300026 GL000192.1 216599 . C A 223.55 \n",
"300027 GL000192.1 228788 . G T 46.77 \n",
"300028 GL000192.1 229867 . C T 2232.98 \n",
"300029 GL000192.1 272061 . C CT 125.59 \n",
"300030 GL000192.1 311575 . C T 248.50 \n",
"300031 GL000192.1 313293 . G A 174.79 \n",
"300032 GL000192.1 313701 . T C 120.67 \n",
"300033 GL000192.1 337826 . TA T 489.51 \n",
"300034 GL000192.1 394140 . A G 45.26 \n",
"300035 10 123256215 . T G 100.00 \n",
"\n",
" FILTER \\\n",
"0 VQSRTrancheSNP99.00to99.90 \n",
"1 VQSRTrancheSNP99.00to99.90 \n",
"2 VQSRTrancheSNP99.90to100.00 \n",
"3 VQSRTrancheSNP99.90to100.00 \n",
"4 VQSRTrancheSNP99.00to99.90 \n",
"5 VQSRTrancheSNP99.90to100.00 \n",
"6 PASS \n",
"7 VQSRTrancheSNP99.90to100.00 \n",
"8 VQSRTrancheSNP99.00to99.90 \n",
"9 VQSRTrancheSNP99.00to99.90 \n",
"10 VQSRTrancheSNP99.90to100.00 \n",
"11 VQSRTrancheSNP99.90to100.00 \n",
"12 PASS \n",
"13 PASS \n",
"14 PASS \n",
"15 VQSRTrancheSNP99.90to100.00 \n",
"16 VQSRTrancheSNP99.00to99.90 \n",
"17 PASS \n",
"18 PASS \n",
"19 PASS \n",
"20 VQSRTrancheSNP99.00to99.90 \n",
"21 VQSRTrancheSNP99.00to99.90 \n",
"22 VQSRTrancheSNP99.90to100.00 \n",
"23 VQSRTrancheSNP99.90to100.00 \n",
"24 VQSRTrancheSNP99.90to100.00 \n",
"25 PASS \n",
"26 PASS \n",
"27 PASS \n",
"28 PASS \n",
"29 PASS \n",
"... ... \n",
"300006 PASS \n",
"300007 PASS \n",
"300008 PASS \n",
"300009 PASS \n",
"300010 VQSRTrancheSNP99.90to100.00 \n",
"300011 VQSRTrancheSNP99.90to100.00 \n",
"300012 VQSRTrancheSNP99.90to100.00 \n",
"300013 VQSRTrancheSNP99.00to99.90 \n",
"300014 VQSRTrancheSNP99.00to99.90 \n",
"300015 VQSRTrancheSNP99.90to100.00 \n",
"300016 VQSRTrancheSNP99.00to99.90 \n",
"300017 VQSRTrancheSNP99.00to99.90 \n",
"300018 VQSRTrancheSNP99.90to100.00 \n",
"300019 VQSRTrancheSNP99.00to99.90 \n",
"300020 VQSRTrancheSNP99.90to100.00 \n",
"300021 VQSRTrancheSNP99.90to100.00 \n",
"300022 PASS \n",
"300023 PASS \n",
"300024 VQSRTrancheSNP99.90to100.00 \n",
"300025 VQSRTrancheSNP99.90to100.00 \n",
"300026 VQSRTrancheSNP99.90to100.00 \n",
"300027 VQSRTrancheSNP99.90to100.00 \n",
"300028 VQSRTrancheSNP99.90to100.00 \n",
"300029 PASS \n",
"300030 PASS \n",
"300031 VQSRTrancheSNP99.90to100.00 \n",
"300032 PASS \n",
"300033 PASS \n",
"300034 PASS \n",
"300035 PASS \n",
"\n",
" INFO FORMAT \\\n",
"0 ABHet=0.628;ABHom=1.00;AC=3;AF=0.375;AN=8;Base... GT:AD:DP:GQ:PL \n",
"1 ABHet=0.644;AC=4;AF=0.500;AN=8;BaseQRankSum=-5... GT:AD:DP:GQ:PL \n",
"2 ABHet=0.846;ABHom=1.00;AC=2;AF=0.250;AN=8;Base... GT:AD:DP:GQ:PL \n",
"3 ABHet=0.359;ABHom=1.00;AC=5;AF=0.625;AN=8;Base... GT:AD:DP:GQ:PL \n",
"4 ABHet=0.735;ABHom=1.00;AC=2;AF=0.250;AN=8;Base... GT:AD:DP:GQ:PL \n",
"5 ABHet=0.705;ABHom=1.00;AC=2;AF=0.333;AN=6;Base... GT:AD:DP:GQ:PL \n",
"6 AC=3;AF=0.500;AN=6;BaseQRankSum=-0.960;DP=42;F... GT:AD:DP:GQ:PL \n",
"7 ABHom=0.982;AC=8;AF=1.00;AN=8;BaseQRankSum=2.0... GT:AD:DP:GQ:PL \n",
"8 ABHet=0.636;ABHom=0.929;AC=1;AF=0.167;AN=6;Bas... GT:AD:DP:GQ:PL \n",
"9 ABHet=0.750;ABHom=0.841;AC=3;AF=0.500;AN=6;Bas... GT:AD:DP:GQ:PL \n",
"10 ABHom=1.00;AC=4;AF=1.00;AN=4;DB;DP=3;Dels=0.00... GT:AD:DP:GQ:PL \n",
"11 ABHet=0.702;ABHom=0.938;AC=3;AF=0.375;AN=8;Bas... GT:AD:DP:GQ:PL \n",
"12 AC=4;AF=0.500;AN=8;BaseQRankSum=1.905;DB;DP=64... GT:AD:DP:GQ:PL \n",
"13 ABHom=1.00;AC=6;AF=1.00;AN=6;DB;DP=4;Dels=0.00... GT:AD:DP:GQ:PL \n",
"14 ABHom=1.00;AC=6;AF=1.00;AN=6;DB;DP=7;Dels=0.00... GT:AD:DP:GQ:PL \n",
"15 ABHom=1.00;AC=6;AF=1.00;AN=6;DB;DP=31;Dels=0.0... GT:AD:DP:GQ:PL \n",
"16 ABHom=0.952;AC=6;AF=1.00;AN=6;DB;DP=15;Dels=0.... GT:AD:DP:GQ:PL \n",
"17 ABHom=1.00;AC=2;AF=1.00;AN=2;DB;DP=2;Dels=0.00... GT:AD:DP:GQ:PL \n",
"18 ABHom=1.00;AC=4;AF=1.00;AN=4;DB;DP=2;Dels=0.00... GT:AD:DP:GQ:PL \n",
"19 ABHom=1.000;AC=8;AF=1.00;AN=8;DB;DP=52;Dels=0.... GT:AD:DP:GQ:PL \n",
"20 ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=222;Dels=0.... GT:AD:DP:GQ:PL \n",
"21 ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=234;Dels=0.... GT:AD:DP:GQ:PL \n",
"22 ABHet=0.800;ABHom=0.936;AC=2;AF=0.250;AN=8;Bas... GT:AD:DP:GQ:PL \n",
"23 ABHet=0.865;ABHom=0.932;AC=1;AF=0.125;AN=8;Bas... GT:AD:DP:GQ:PL \n",
"24 ABHet=0.864;ABHom=0.950;AC=1;AF=0.125;AN=8;Bas... GT:AD:DP:GQ:PL \n",
"25 ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=13;Dels=0.0... GT:AD:DP:GQ:PL \n",
"26 ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=13;Dels=0.0... GT:AD:DP:GQ:PL \n",
"27 ABHom=1.00;AC=2;AF=0.500;AN=4;BaseQRankSum=0.3... GT:AD:DP:GQ:PL \n",
"28 ABHom=1.00;AC=2;AF=1.00;AN=2;DB;DP=2;Dels=0.00... GT:AD:DP:GQ:PL \n",
"29 ABHom=1.00;AC=2;AF=1.00;AN=2;DB;DP=2;Dels=0.00... GT:AD:DP:GQ:PL \n",
"... ... ... \n",
"300006 ABHom=1.00;AC=2;AF=1.00;AN=2;DP=3;Dels=0.00;FS... GT:AD:DP:GQ:PL \n",
"300007 ABHom=1.00;AC=2;AF=1.00;AN=2;DP=3;Dels=0.00;FS... GT:AD:DP:GQ:PL \n",
"300008 ABHom=1.00;AC=2;AF=1.00;AN=2;DP=2;Dels=0.00;FS... GT:AD:DP:GQ:PL \n",
"300009 ABHom=1.00;AC=4;AF=1.00;AN=4;DP=3;Dels=0.00;FS... GT:AD:DP:GQ:PL \n",
"300010 ABHet=0.594;ABHom=1.00;AC=3;AF=0.375;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300011 ABHet=0.648;ABHom=0.800;AC=5;AF=0.625;AN=8;Bas... GT:AD:DP:GQ:PL \n",
"300012 ABHet=0.527;ABHom=1.00;AC=2;AF=0.250;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300013 ABHet=0.442;ABHom=1.00;AC=4;AF=0.667;AN=6;Base... GT:AD:DP:GQ:PL \n",
"300014 ABHet=0.378;ABHom=1.00;AC=5;AF=0.625;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300015 ABHet=0.429;ABHom=1.00;AC=3;AF=0.375;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300016 ABHet=0.662;ABHom=1.00;AC=2;AF=0.250;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300017 ABHet=0.460;ABHom=1.00;AC=2;AF=0.250;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300018 ABHet=0.663;ABHom=1.00;AC=2;AF=0.250;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300019 ABHet=0.450;ABHom=1.00;AC=3;AF=0.375;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300020 ABHet=0.460;ABHom=1.00;AC=3;AF=0.375;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300021 ABHet=0.451;ABHom=1.00;AC=2;AF=0.250;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300022 AC=4;AF=0.500;AN=8;BaseQRankSum=-3.358;DP=66;F... GT:AD:DP:GQ:PL \n",
"300023 ABHet=0.625;ABHom=1.00;AC=6;AF=0.750;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300024 ABHom=1.00;AC=4;AF=1.00;AN=4;DP=7;Dels=0.00;FS... GT:AD:DP:GQ:PL \n",
"300025 ABHet=0.498;AC=4;AF=0.500;AN=8;BaseQRankSum=0.... GT:AD:DP:GQ:PL \n",
"300026 ABHet=0.492;ABHom=1.00;AC=2;AF=0.250;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300027 ABHom=0.500;AC=2;AF=1.00;AN=2;DP=10;Dels=0.00;... GT:AD:DP:GQ:PL \n",
"300028 ABHom=0.857;AC=8;AF=1.00;AN=8;DP=111;Dels=0.00... GT:AD:DP:GQ:PL \n",
"300029 AC=3;AF=0.375;AN=8;BaseQRankSum=-0.058;DP=33;F... GT:AD:DP:GQ:PL \n",
"300030 ABHet=0.333;ABHom=1.00;AC=3;AF=0.375;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300031 ABHet=0.640;ABHom=1.00;AC=3;AF=0.375;AN=8;Base... GT:AD:DP:GQ:PL \n",
"300032 ABHom=1.00;AC=6;AF=1.00;AN=6;DP=4;Dels=0.00;FS... GT:AD:DP:GQ:PL \n",
"300033 AC=2;AF=0.250;AN=8;BaseQRankSum=-3.725;DP=62;F... GT:AD:DP:GQ:PL \n",
"300034 ABHom=1.00;AC=2;AF=0.500;AN=4;BaseQRankSum=0.7... GT:AD:DP:GQ:PL \n",
"300035 GENE=FGFR2;INHERITANCE=AD;MIM=101600 GT:AD:DP:GQ:PL \n",
"\n",
" ISDBM322015 ISDBM322016 \\\n",
"0 0/0:6,0:6:18:0,18,178 0/1:17,10:27:99:208,0,341 \n",
"1 0/1:6,1:7:7:7,0,150 0/1:16,13:29:99:296,0,378 \n",
"2 0/0:10,0:10:24:0,24,228 0/0:32,0:32:81:0,81,734 \n",
"3 0/1:1,1:2:17:17,0,17 0/1:3,5:8:8:76,0,8 \n",
"4 0/0:2,0:2:6:0,6,80 0/1:10,2:13:51:51,0,138 \n",
"5 ./. 0/1:31,15:46:99:340,0,308 \n",
"6 ./. 1/1:6,2:4:6:116,6,0 \n",
"7 1/1:2,171:173:99:2218,228,0 1/1:0,33:34:60:508,60,0 \n",
"8 ./. 0/0:11,0:11:33:0,33,436 \n",
"9 1/1:1,3:4:9:109,9,0 0/1:3,1:4:20:20,0,107 \n",
"10 1/1:0,2:2:6:49,6,0 ./. \n",
"11 0/1:3,1:4:13:13,0,60 0/0:15,1:16:8:0,8,212 \n",
"12 0/1:4,1:5:32:32,0,185 0/1:17,4:18:99:132,0,623 \n",
"13 ./. 1/1:0,2:2:6:79,6,0 \n",
"14 ./. 1/1:0,2:2:6:80,6,0 \n",
"15 ./. 1/1:0,14:14:24:221,24,0 \n",
"16 ./. 1/1:0,3:3:9:118,9,0 \n",
"17 1/1:0,2:2:6:77,6,0 ./. \n",
"18 1/1:0,1:1:3:40,3,0 ./. \n",
"19 1/1:0,7:7:21:223,21,0 1/1:0,16:16:48:602,48,0 \n",
"20 1/1:0,43:43:96:1199,96,0 1/1:0,62:62:99:1304,102,0 \n",
"21 1/1:0,48:48:99:1318,111,0 1/1:0,61:61:99:1456,114,0 \n",
"22 0/1:35,6:41:36:36,0,520 0/1:44,15:59:99:109,0,657 \n",
"23 0/1:64,10:74:80:80,0,2123 0/0:58,2:60:99:0,121,2171 \n",
"24 0/1:57,9:67:77:77,0,1851 0/0:57,2:60:99:0,115,2057 \n",
"25 1/1:0,3:3:9:95,9,0 1/1:0,5:5:15:175,15,0 \n",
"26 1/1:0,5:5:15:185,15,0 1/1:0,4:4:12:148,12,0 \n",
"27 ./. 1/1:0,2:2:6:75,6,0 \n",
"28 ./. 1/1:0,2:2:6:80,6,0 \n",
"29 1/1:0,2:2:6:77,6,0 ./. \n",
"... ... ... \n",
"300006 ./. 1/1:0,3:3:9:113,9,0 \n",
"300007 ./. 1/1:0,3:3:9:119,9,0 \n",
"300008 ./. ./. \n",
"300009 1/1:0,2:2:6:80,6,0 1/1:0,1:1:3:32,3,0 \n",
"300010 0/1:37,35:72:99:680,0,597 0/1:30,11:41:99:211,0,460 \n",
"300011 0/1:21,12:33:99:143,0,226 0/1:13,12:25:99:223,0,167 \n",
"300012 0/0:3,0:3:6:0,6,55 0/0:7,0:7:12:0,12,111 \n",
"300013 ./. 0/1:2,1:3:19:19,0,66 \n",
"300014 0/1:6,3:9:93:93,0,186 0/1:3,7:10:75:222,0,75 \n",
"300015 0/1:10,7:17:99:146,0,201 0/1:3,7:10:28:166,0,28 \n",
"300016 0/0:24,0:24:45:0,45,511 0/0:12,0:12:27:0,27,328 \n",
"300017 0/0:39,0:39:78:0,78,1000 0/0:24,0:24:45:0,45,579 \n",
"300018 0/0:45,0:45:51:0,51,470 0/0:29,0:29:51:0,51,463 \n",
"300019 0/1:19,19:38:99:492,0,361 0/1:16,15:31:99:394,0,386 \n",
"300020 0/1:3,3:6:65:65,0,65 0/1:10,9:19:99:155,0,125 \n",
"300021 0/0:27,0:27:57:0,57,725 0/0:18,0:18:30:0,30,363 \n",
"300022 1/1:7,18:20:51:677,51,0 0/1:9,6:10:33:204,0,33 \n",
"300023 0/1:2,2:4:52:60,0,52 0/1:3,1:4:25:25,0,105 \n",
"300024 ./. ./. \n",
"300025 0/1:18,23:41:99:291,0,208 0/1:6,12:18:99:253,0,114 \n",
"300026 0/0:46,0:46:99:0,102,941 0/0:19,0:19:33:0,33,304 \n",
"300027 ./. 1/1:2,2:4:6:78,6,0 \n",
"300028 1/1:4,25:29:66:609,66,0 1/1:2,25:27:57:528,57,0 \n",
"300029 0/0:5,0:4:9:0,9,93 0/1:5,4:7:12:107,0,12 \n",
"300030 0/0:2,0:2:3:0,3,39 0/1:3,6:9:93:212,0,93 \n",
"300031 0/1:42,16:58:55:55,0,587 0/0:34,0:34:42:0,42,447 \n",
"300032 ./. 1/1:0,1:1:3:40,3,0 \n",
"300033 0/0:18,0:18:51:0,51,855 0/0:13,0:13:39:0,39,695 \n",
"300034 ./. 0/0:1,0:1:3:0,3,39 \n",
"300035 0/0:1,0:1:3:0,3,39 0/0:1,0:1:3:0,3,39 \n",
"\n",
" ISDBM322017 ISDBM322018 \n",
"0 0/1:14,9:23:99:176,0,258 0/1:20,11:31:99:174,0,380 \n",
"1 0/1:19,13:32:99:245,0,420 0/1:24,15:39:99:274,0,535 \n",
"2 0/1:28,6:34:79:79,0,549 0/1:41,6:47:8:8,0,850 \n",
"3 1/1:0,1:1:3:23,3,0 0/1:1,4:5:14:36,0,14 \n",
"4 0/0:23,1:24:0:0,0,418 0/1:14,8:22:99:139,0,243 \n",
"5 0/1:25,9:34:99:159,0,394 0/0:52,0:52:90:0,90,830 \n",
"6 0/1:8,4:8:99:128,0,301 0/0:18,2:15:30:0,30,666 \n",
"7 1/1:0,61:63:93:777,93,0 1/1:0,61:61:96:790,96,0 \n",
"8 0/0:6,1:7:18:0,18,240 0/1:7,4:11:70:70,0,229 \n",
"9 ./. 0/0:1,0:1:3:0,3,40 \n",
"10 ./. 1/1:0,1:1:3:28,3,0 \n",
"11 0/1:4,4:8:71:75,0,71 0/1:13,2:15:13:13,0,203 \n",
"12 0/1:9,7:16:99:273,0,395 0/1:16,4:19:99:125,0,661 \n",
"13 1/1:0,1:1:3:39,3,0 1/1:0,1:1:3:36,3,0 \n",
"14 1/1:0,4:4:12:159,12,0 1/1:0,1:1:3:40,3,0 \n",
"15 1/1:0,8:8:12:111,12,0 1/1:0,9:9:15:138,15,0 \n",
"16 1/1:0,6:7:9:83,9,0 1/1:0,5:5:9:108,9,0 \n",
"17 ./. ./. \n",
"18 1/1:0,1:1:3:40,3,0 ./. \n",
"19 1/1:0,13:13:36:457,36,0 1/1:0,16:16:48:611,48,0 \n",
"20 1/1:0,58:58:93:1169,93,0 1/1:0,59:59:99:1288,102,0 \n",
"21 1/1:0,63:63:99:1383,111,0 1/1:0,62:62:99:1448,114,0 \n",
"22 0/0:47,5:52:57:0,57,722 0/0:31,0:32:78:0,78,634 \n",
"23 0/0:42,4:46:17:0,17,1486 0/0:54,5:59:29:0,29,1912 \n",
"24 0/0:46,3:49:59:0,59,1686 0/0:53,3:56:74:0,74,1828 \n",
"25 1/1:0,2:2:6:55,6,0 1/1:0,3:3:9:99,9,0 \n",
"26 1/1:0,2:2:6:55,6,0 1/1:0,2:2:6:79,6,0 \n",
"27 ./. 0/0:3,0:3:9:0,9,99 \n",
"28 ./. ./. \n",
"29 ./. ./. \n",
"... ... ... \n",
"300006 ./. ./. \n",
"300007 ./. ./. \n",
"300008 ./. 1/1:0,2:2:6:78,6,0 \n",
"300009 ./. ./. \n",
"300010 0/1:15,13:28:99:285,0,257 0/0:45,0:45:99:0,123,1131 \n",
"300011 0/1:26,7:33:99:127,0,155 1/1:4,16:20:36:328,36,0 \n",
"300012 0/1:5,4:9:13:96,0,13 0/1:5,5:10:19:19,0,46 \n",
"300013 0/1:1,4:5:11:120,0,11 1/1:0,1:1:3:28,3,0 \n",
"300014 0/1:1,5:6:23:133,0,23 1/1:0,3:3:9:90,9,0 \n",
"300015 0/0:7,0:7:18:0,18,166 0/1:2,3:5:43:43,0,43 \n",
"300016 0/1:6,5:12:99:124,0,131 0/1:14,4:18:67:67,0,313 \n",
"300017 0/1:9,11:20:45:310,0,45 0/1:8,9:17:99:172,0,133 \n",
"300018 0/1:20,7:27:87:87,0,281 0/1:17,12:29:99:241,0,209 \n",
"300019 0/0:28,0:28:84:0,84,918 0/1:6,12:18:99:358,0,137 \n",
"300020 0/0:15,0:15:36:0,36,332 0/1:6,11:17:75:184,0,75 \n",
"300021 0/1:11,4:15:48:48,0,280 0/1:1,5:6:21:159,0,21 \n",
"300022 0/1:8,7:10:19:280,0,19 0/0:6,0:6:9:0,9,141 \n",
"300023 1/1:0,2:2:6:78,6,0 1/1:0,1:1:3:37,3,0 \n",
"300024 1/1:0,4:4:12:111,12,0 1/1:0,3:3:9:83,9,0 \n",
"300025 0/1:7,4:11:62:62,0,90 0/1:11,1:12:1:1,0,194 \n",
"300026 0/1:5,6:11:56:139,0,56 0/1:9,8:17:99:126,0,130 \n",
"300027 ./. ./. \n",
"300028 1/1:6,23:29:66:609,66,0 1/1:4,22:26:57:526,57,0 \n",
"300029 0/1:9,2:3:18:53,0,18 0/1:6,1:4:17:17,0,69 \n",
"300030 1/1:0,2:2:6:80,6,0 0/0:5,0:5:15:0,15,181 \n",
"300031 0/1:26,10:36:57:57,0,367 0/1:19,21:40:99:106,0,367 \n",
"300032 1/1:0,1:1:3:39,3,0 1/1:0,2:2:6:77,6,0 \n",
"300033 0/1:5,10:15:99:438,0,228 0/1:13,3:16:99:102,0,647 \n",
"300034 ./. 1/1:0,2:2:6:80,6,0 \n",
"300035 1/0:1,0:1:3:0,3,39 0/0:1,0:1:3:0,3,39 \n",
"\n",
"[300036 rows x 13 columns]"
]
},
"execution_count": 3,
"metadata": {},
"output_type": "execute_result"
}
],
"source": [
"df = pd.read_table('Pfeiffer-quartet.vcf', skiprows=134, dtype={'#CHROM': str})\n",
"df"
]
},
{
"cell_type": "code",
"execution_count": 4,
"metadata": {
"collapsed": false,
"scrolled": true
},
"outputs": [
{
"data": {
"text/plain": [
"A 74449\n",
"T 73785\n",
"G 72981\n",
"C 72857\n",
"TA 509\n",
"CT 493\n",
"AT 479\n",
"GA 424\n",
"CA 395\n",
"GT 359\n",
"AG 256\n",
"TG 233\n",
"GC 219\n",
"TC 157\n",
"AC 152\n",
"CG 63\n",
"A,T 56\n",
"CTT 50\n",
"CAT 45\n",
"TAA 42\n",
"C,CT 41\n",
"A,C 41\n",
"CAA 40\n",
"TAC 37\n",
"A,G 37\n",
"CAG 37\n",
"C,T 36\n",
"C,G 36\n",
"CCT 35\n",
"G,T 35\n",
" ... \n",
"ATTC 1\n",
"C,CGT 1\n",
"CAACA 1\n",
"TAAA,TA 1\n",
"GTGTT 1\n",
"GATAA 1\n",
"CAGAGAG,C 1\n",
"AGGG 1\n",
"GGAGGAA 1\n",
"GCCTT 1\n",
"G,GTT 1\n",
"GGGT 1\n",
"CTCAT 1\n",
"TACTG 1\n",
"CGGT 1\n",
"GGTTT 1\n",
"CACCT 1\n",
"GA,G 1\n",
"GGGGCTGGTACACACAGGTCAGCACGGCCAGGTTCCCACTCCCG 1\n",
"GT,G 1\n",
"G,GAAA 1\n",
"CATAT 1\n",
"TTGTG,T 1\n",
"CTTAT 1\n",
"GACAC,G 1\n",
"ACCAT 1\n",
"CAAA,C 1\n",
"ACTAT 1\n",
"GTAAA 1\n",
"CCTCTCT,C 1\n",
"Name: ALT, dtype: int64"
]
},
"execution_count": 4,
"metadata": {},
"output_type": "execute_result"
}
],
"source": [
"df['ALT'].value_counts()"
]
},
{
"cell_type": "code",
"execution_count": 5,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"<class 'pandas.core.frame.DataFrame'>\n",
"RangeIndex: 300036 entries, 0 to 300035\n",
"Data columns (total 13 columns):\n",
"#CHROM 300036 non-null object\n",
"POS 300036 non-null int64\n",
"ID 300036 non-null object\n",
"REF 300036 non-null object\n",
"ALT 300036 non-null object\n",
"QUAL 300036 non-null float64\n",
"FILTER 300036 non-null object\n",
"INFO 300036 non-null object\n",
"FORMAT 300036 non-null object\n",
"ISDBM322015 300036 non-null object\n",
"ISDBM322016 300036 non-null object\n",
"ISDBM322017 300036 non-null object\n",
"ISDBM322018 300036 non-null object\n",
"dtypes: float64(1), int64(1), object(11)\n",
"memory usage: 29.8+ MB\n"
]
}
],
"source": [
"df.info()"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"FILTER가 PASS인 레코드만 취합"
]
},
{
"cell_type": "code",
"execution_count": 6,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"<class 'pandas.core.frame.DataFrame'>\n",
"Int64Index: 268101 entries, 6 to 300035\n",
"Data columns (total 13 columns):\n",
"#CHROM 268101 non-null object\n",
"POS 268101 non-null int64\n",
"ID 268101 non-null object\n",
"REF 268101 non-null object\n",
"ALT 268101 non-null object\n",
"QUAL 268101 non-null float64\n",
"FILTER 268101 non-null object\n",
"INFO 268101 non-null object\n",
"FORMAT 268101 non-null object\n",
"ISDBM322015 268101 non-null object\n",
"ISDBM322016 268101 non-null object\n",
"ISDBM322017 268101 non-null object\n",
"ISDBM322018 268101 non-null object\n",
"dtypes: float64(1), int64(1), object(11)\n",
"memory usage: 28.6+ MB\n"
]
}
],
"source": [
"dfc = df[df['FILTER'] == 'PASS']\n",
"dfc.info()"
]
},
{
"cell_type": "code",
"execution_count": 7,
"metadata": {
"collapsed": true
},
"outputs": [],
"source": [
"dfc = dfc.reset_index()"
]
},
{
"cell_type": "code",
"execution_count": 8,
"metadata": {
"collapsed": false,
"scrolled": true
},
"outputs": [
{
"data": {
"text/html": [
"<div>\n",
"<table border=\"1\" class=\"dataframe\">\n",
" <thead>\n",
" <tr style=\"text-align: right;\">\n",
" <th></th>\n",
" <th>ISDBM322015 genotype</th>\n",
" <th>ISDBM322016 genotype</th>\n",
" <th>ISDBM322017 genotype</th>\n",
" <th>ISDBM322018 genotype</th>\n",
" </tr>\n",
" </thead>\n",
" <tbody>\n",
" <tr>\n",
" <th>0</th>\n",
" <td>-</td>\n",
" <td>C-C</td>\n",
" <td>CCTA-C</td>\n",
" <td>CCTA-CCTA</td>\n",
" </tr>\n",
" <tr>\n",
" <th>1</th>\n",
" <td>TA-T</td>\n",
" <td>TA-T</td>\n",
" <td>TA-T</td>\n",
" <td>TA-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>2</th>\n",
" <td>-</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" </tr>\n",
" <tr>\n",
" <th>3</th>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>4</th>\n",
" <td>C-C</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>5</th>\n",
" <td>T-T</td>\n",
" <td>-</td>\n",
" <td>T-T</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>6</th>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" </tr>\n",
" <tr>\n",
" <th>7</th>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>8</th>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>9</th>\n",
" <td>-</td>\n",
" <td>A-A</td>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>10</th>\n",
" <td>-</td>\n",
" <td>C-C</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>11</th>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>12</th>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>13</th>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>14</th>\n",
" <td>T-T</td>\n",
" <td>C-C</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>15</th>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" </tr>\n",
" <tr>\n",
" <th>16</th>\n",
" <td>CCCCT-CCCCT</td>\n",
" <td>CCCCT-CCCCT</td>\n",
" <td>C-C</td>\n",
" <td>CCCCT-CCCCT</td>\n",
" </tr>\n",
" <tr>\n",
" <th>17</th>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>18</th>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>T-T</td>\n",
" <td>T-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>19</th>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" </tr>\n",
" <tr>\n",
" <th>20</th>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" <td>-</td>\n",
" <td>C-C</td>\n",
" </tr>\n",
" <tr>\n",
" <th>21</th>\n",
" <td>-</td>\n",
" <td>T-T</td>\n",
" <td>G-G</td>\n",
" <td>G-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>22</th>\n",
" <td>T-T</td>\n",
" <td>T-T</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>23</th>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>24</th>\n",
" <td>C-C</td>\n",
" <td>C-G</td>\n",
" <td>C-G</td>\n",
" <td>C-C</td>\n",
" </tr>\n",
" <tr>\n",
" <th>25</th>\n",
" <td>C-T</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" <td>C-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>26</th>\n",
" <td>G-C</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-C</td>\n",
" </tr>\n",
" <tr>\n",
" <th>27</th>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" </tr>\n",
" <tr>\n",
" <th>28</th>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" </tr>\n",
" <tr>\n",
" <th>29</th>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>...</th>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268071</th>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268072</th>\n",
" <td>GT-G</td>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268073</th>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>A-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268074</th>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>A-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268075</th>\n",
" <td>C-C</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>C-C</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268076</th>\n",
" <td>T-T</td>\n",
" <td>-</td>\n",
" <td>T-T</td>\n",
" <td>C-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268077</th>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>T-T</td>\n",
" <td>A-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268078</th>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" <td>A-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268079</th>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268080</th>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268081</th>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268082</th>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268083</th>\n",
" <td>-</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268084</th>\n",
" <td>T-T</td>\n",
" <td>T-T</td>\n",
" <td>T-T</td>\n",
" <td>T-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268085</th>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268086</th>\n",
" <td>TC-TC</td>\n",
" <td>TC-TC</td>\n",
" <td>TC-TC</td>\n",
" <td>T-TC</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268087</th>\n",
" <td>C-C</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268088</th>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268089</th>\n",
" <td>-</td>\n",
" <td>T-T</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268090</th>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268091</th>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>T-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268092</th>\n",
" <td>T-T</td>\n",
" <td>T-T</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268093</th>\n",
" <td>C-C</td>\n",
" <td>CTG-C</td>\n",
" <td>CTG-C</td>\n",
" <td>CTG-CTG</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268094</th>\n",
" <td>C-T</td>\n",
" <td>C-T</td>\n",
" <td>T-T</td>\n",
" <td>T-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268095</th>\n",
" <td>C-C</td>\n",
" <td>C-CT</td>\n",
" <td>C-CT</td>\n",
" <td>C-CT</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268096</th>\n",
" <td>C-C</td>\n",
" <td>C-T</td>\n",
" <td>T-T</td>\n",
" <td>C-C</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268097</th>\n",
" <td>-</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268098</th>\n",
" <td>TA-TA</td>\n",
" <td>TA-TA</td>\n",
" <td>TA-T</td>\n",
" <td>TA-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268099</th>\n",
" <td>-</td>\n",
" <td>A-A</td>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268100</th>\n",
" <td>T-T</td>\n",
" <td>T-T</td>\n",
" <td>G-T</td>\n",
" <td>T-T</td>\n",
" </tr>\n",
" </tbody>\n",
"</table>\n",
"<p>268101 rows × 4 columns</p>\n",
"</div>"
],
"text/plain": [
" ISDBM322015 genotype ISDBM322016 genotype ISDBM322017 genotype \\\n",
"0 - C-C CCTA-C \n",
"1 TA-T TA-T TA-T \n",
"2 - A-A A-A \n",
"3 - G-G G-G \n",
"4 C-C - - \n",
"5 T-T - T-T \n",
"6 A-A A-A A-A \n",
"7 G-G G-G G-G \n",
"8 G-G G-G G-G \n",
"9 - A-A - \n",
"10 - C-C - \n",
"11 G-G - - \n",
"12 G-G G-G - \n",
"13 G-G - - \n",
"14 T-T C-C - \n",
"15 A-A A-A A-A \n",
"16 CCCCT-CCCCT CCCCT-CCCCT C-C \n",
"17 - - G-G \n",
"18 - - T-T \n",
"19 - - C-C \n",
"20 C-C C-C - \n",
"21 - T-T G-G \n",
"22 T-T T-T - \n",
"23 G-G G-G - \n",
"24 C-C C-G C-G \n",
"25 C-T C-C C-C \n",
"26 G-C G-G G-G \n",
"27 A-A A-A A-A \n",
"28 C-C C-C C-C \n",
"29 G-G G-G G-G \n",
"... ... ... ... \n",
"268071 G-G - G-G \n",
"268072 GT-G G-G - \n",
"268073 G-G - - \n",
"268074 G-G - - \n",
"268075 C-C - - \n",
"268076 T-T - T-T \n",
"268077 - - T-T \n",
"268078 - - G-G \n",
"268079 G-G - - \n",
"268080 C-C C-C C-C \n",
"268081 G-G G-G G-G \n",
"268082 G-G - - \n",
"268083 - C-C C-C \n",
"268084 T-T T-T T-T \n",
"268085 G-G G-G - \n",
"268086 TC-TC TC-TC TC-TC \n",
"268087 C-C - - \n",
"268088 G-G - - \n",
"268089 - T-T - \n",
"268090 - G-G - \n",
"268091 - - - \n",
"268092 T-T T-T - \n",
"268093 C-C CTG-C CTG-C \n",
"268094 C-T C-T T-T \n",
"268095 C-C C-CT C-CT \n",
"268096 C-C C-T T-T \n",
"268097 - C-C C-C \n",
"268098 TA-TA TA-TA TA-T \n",
"268099 - A-A - \n",
"268100 T-T T-T G-T \n",
"\n",
" ISDBM322018 genotype \n",
"0 CCTA-CCTA \n",
"1 TA-T \n",
"2 A-A \n",
"3 G-G \n",
"4 - \n",
"5 - \n",
"6 A-A \n",
"7 G-G \n",
"8 G-G \n",
"9 G-G \n",
"10 - \n",
"11 - \n",
"12 - \n",
"13 G-G \n",
"14 - \n",
"15 A-A \n",
"16 CCCCT-CCCCT \n",
"17 G-G \n",
"18 T-T \n",
"19 C-C \n",
"20 C-C \n",
"21 G-T \n",
"22 - \n",
"23 - \n",
"24 C-C \n",
"25 C-T \n",
"26 G-C \n",
"27 A-A \n",
"28 C-C \n",
"29 G-G \n",
"... ... \n",
"268071 G-G \n",
"268072 G-G \n",
"268073 A-G \n",
"268074 A-G \n",
"268075 C-C \n",
"268076 C-T \n",
"268077 A-T \n",
"268078 A-G \n",
"268079 - \n",
"268080 - \n",
"268081 G-G \n",
"268082 - \n",
"268083 - \n",
"268084 T-T \n",
"268085 - \n",
"268086 T-TC \n",
"268087 - \n",
"268088 - \n",
"268089 - \n",
"268090 - \n",
"268091 T-T \n",
"268092 - \n",
"268093 CTG-CTG \n",
"268094 T-T \n",
"268095 C-CT \n",
"268096 C-C \n",
"268097 C-C \n",
"268098 TA-T \n",
"268099 G-G \n",
"268100 T-T \n",
"\n",
"[268101 rows x 4 columns]"
]
},
"execution_count": 8,
"metadata": {},
"output_type": "execute_result"
}
],
"source": [
"sample_ids = ['ISDBM322015', 'ISDBM322016', 'ISDBM322017', 'ISDBM322018']\n",
"sample_ids_genotype = ['{} genotype'.format(s) for s in sample_ids]\n",
"\n",
"def call_genotype(row):\n",
" alts = row['ALT'].split(',')\n",
" m = {\n",
" '0': row['REF'],\n",
" '1': alts[0],\n",
" '2': alts[1] if len(alts) == 2 else alts[0],\n",
" '3': alts[2] if len(alts) == 3 else alts[0],\n",
" '.': '',\n",
" }\n",
" return pd.Series(['{}-{}'.format(\n",
" m[row[s][0]], m[row[s][2]]) for s in sample_ids if s], \n",
" index=sample_ids_genotype)\n",
"\n",
"genotypes = dfc.apply(call_genotype, axis=1)\n",
"genotypes"
]
},
{
"cell_type": "code",
"execution_count": 9,
"metadata": {
"collapsed": false,
"scrolled": true
},
"outputs": [
{
"data": {
"text/html": [
"<div>\n",
"<table border=\"1\" class=\"dataframe\">\n",
" <thead>\n",
" <tr style=\"text-align: right;\">\n",
" <th></th>\n",
" <th>index</th>\n",
" <th>#CHROM</th>\n",
" <th>POS</th>\n",
" <th>ID</th>\n",
" <th>REF</th>\n",
" <th>ALT</th>\n",
" <th>QUAL</th>\n",
" <th>FILTER</th>\n",
" <th>INFO</th>\n",
" <th>FORMAT</th>\n",
" <th>ISDBM322015</th>\n",
" <th>ISDBM322016</th>\n",
" <th>ISDBM322017</th>\n",
" <th>ISDBM322018</th>\n",
" <th>ISDBM322015 genotype</th>\n",
" <th>ISDBM322016 genotype</th>\n",
" <th>ISDBM322017 genotype</th>\n",
" <th>ISDBM322018 genotype</th>\n",
" </tr>\n",
" </thead>\n",
" <tbody>\n",
" <tr>\n",
" <th>0</th>\n",
" <td>6</td>\n",
" <td>1</td>\n",
" <td>63735</td>\n",
" <td>.</td>\n",
" <td>CCTA</td>\n",
" <td>C</td>\n",
" <td>193.23</td>\n",
" <td>PASS</td>\n",
" <td>AC=3;AF=0.500;AN=6;BaseQRankSum=-0.960;DP=42;F...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:6,2:4:6:116,6,0</td>\n",
" <td>0/1:8,4:8:99:128,0,301</td>\n",
" <td>0/0:18,2:15:30:0,30,666</td>\n",
" <td>-</td>\n",
" <td>C-C</td>\n",
" <td>CCTA-C</td>\n",
" <td>CCTA-CCTA</td>\n",
" </tr>\n",
" <tr>\n",
" <th>1</th>\n",
" <td>12</td>\n",
" <td>1</td>\n",
" <td>745370</td>\n",
" <td>rs146246821</td>\n",
" <td>TA</td>\n",
" <td>T</td>\n",
" <td>510.54</td>\n",
" <td>PASS</td>\n",
" <td>AC=4;AF=0.500;AN=8;BaseQRankSum=1.905;DB;DP=64...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:4,1:5:32:32,0,185</td>\n",
" <td>0/1:17,4:18:99:132,0,623</td>\n",
" <td>0/1:9,7:16:99:273,0,395</td>\n",
" <td>0/1:16,4:19:99:125,0,661</td>\n",
" <td>TA-T</td>\n",
" <td>TA-T</td>\n",
" <td>TA-T</td>\n",
" <td>TA-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>2</th>\n",
" <td>13</td>\n",
" <td>1</td>\n",
" <td>752566</td>\n",
" <td>rs3094315</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>118.67</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=6;AF=1.00;AN=6;DB;DP=4;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,2:2:6:79,6,0</td>\n",
" <td>1/1:0,1:1:3:39,3,0</td>\n",
" <td>1/1:0,1:1:3:36,3,0</td>\n",
" <td>-</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" </tr>\n",
" <tr>\n",
" <th>3</th>\n",
" <td>14</td>\n",
" <td>1</td>\n",
" <td>752721</td>\n",
" <td>rs3131972</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>242.70</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=6;AF=1.00;AN=6;DB;DP=7;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,2:2:6:80,6,0</td>\n",
" <td>1/1:0,4:4:12:159,12,0</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>4</th>\n",
" <td>17</td>\n",
" <td>1</td>\n",
" <td>758324</td>\n",
" <td>rs3131955</td>\n",
" <td>T</td>\n",
" <td>C</td>\n",
" <td>45.77</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=2;AF=1.00;AN=2;DB;DP=2;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,2:2:6:77,6,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>C-C</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>5</th>\n",
" <td>18</td>\n",
" <td>1</td>\n",
" <td>780027</td>\n",
" <td>rs2977613</td>\n",
" <td>G</td>\n",
" <td>T</td>\n",
" <td>47.01</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=4;AF=1.00;AN=4;DB;DP=2;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" <td>./.</td>\n",
" <td>T-T</td>\n",
" <td>-</td>\n",
" <td>T-T</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>6</th>\n",
" <td>19</td>\n",
" <td>1</td>\n",
" <td>808631</td>\n",
" <td>rs11240779</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>1853.99</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.000;AC=8;AF=1.00;AN=8;DB;DP=52;Dels=0....</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,7:7:21:223,21,0</td>\n",
" <td>1/1:0,16:16:48:602,48,0</td>\n",
" <td>1/1:0,13:13:36:457,36,0</td>\n",
" <td>1/1:0,16:16:48:611,48,0</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" </tr>\n",
" <tr>\n",
" <th>7</th>\n",
" <td>25</td>\n",
" <td>1</td>\n",
" <td>812267</td>\n",
" <td>rs7541694</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>385.67</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=13;Dels=0.0...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,3:3:9:95,9,0</td>\n",
" <td>1/1:0,5:5:15:175,15,0</td>\n",
" <td>1/1:0,2:2:6:55,6,0</td>\n",
" <td>1/1:0,3:3:9:99,9,0</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>8</th>\n",
" <td>26</td>\n",
" <td>1</td>\n",
" <td>812284</td>\n",
" <td>rs7545373</td>\n",
" <td>C</td>\n",
" <td>G</td>\n",
" <td>428.75</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=13;Dels=0.0...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,5:5:15:185,15,0</td>\n",
" <td>1/1:0,4:4:12:148,12,0</td>\n",
" <td>1/1:0,2:2:6:55,6,0</td>\n",
" <td>1/1:0,2:2:6:79,6,0</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>9</th>\n",
" <td>27</td>\n",
" <td>1</td>\n",
" <td>823790</td>\n",
" <td>rs143626389</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>38.82</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=2;AF=0.500;AN=4;BaseQRankSum=0.3...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,2:2:6:75,6,0</td>\n",
" <td>./.</td>\n",
" <td>0/0:3,0:3:9:0,9,99</td>\n",
" <td>-</td>\n",
" <td>A-A</td>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>10</th>\n",
" <td>28</td>\n",
" <td>1</td>\n",
" <td>834832</td>\n",
" <td>rs4411087</td>\n",
" <td>G</td>\n",
" <td>C</td>\n",
" <td>48.77</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=2;AF=1.00;AN=2;DB;DP=2;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,2:2:6:80,6,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>-</td>\n",
" <td>C-C</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>11</th>\n",
" <td>29</td>\n",
" <td>1</td>\n",
" <td>849998</td>\n",
" <td>rs13303222</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>45.77</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=2;AF=1.00;AN=2;DB;DP=2;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,2:2:6:77,6,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>12</th>\n",
" <td>30</td>\n",
" <td>1</td>\n",
" <td>851757</td>\n",
" <td>rs62677860</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>63.22</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=4;AF=1.00;AN=4;DB;DP=4;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,2:2:6:69,6,0</td>\n",
" <td>1/1:0,2:2:3:28,3,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>13</th>\n",
" <td>31</td>\n",
" <td>1</td>\n",
" <td>861808</td>\n",
" <td>rs13302982</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>66.22</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=4;AF=1.00;AN=4;DB;DP=3;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,2:2:6:64,6,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,1:1:3:36,3,0</td>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>14</th>\n",
" <td>32</td>\n",
" <td>1</td>\n",
" <td>862866</td>\n",
" <td>rs3892970</td>\n",
" <td>C</td>\n",
" <td>T</td>\n",
" <td>31.26</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=2;AF=0.500;AN=4;BaseQRankSum=-0....</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,2:2:6:66,6,0</td>\n",
" <td>0/0:1,0:1:3:0,3,40</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>T-T</td>\n",
" <td>C-C</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>15</th>\n",
" <td>33</td>\n",
" <td>1</td>\n",
" <td>866319</td>\n",
" <td>rs9988021</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>825.39</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=24;Dels=0.0...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,11:11:33:427,33,0</td>\n",
" <td>1/1:0,7:7:18:228,18,0</td>\n",
" <td>1/1:0,4:4:12:133,12,0</td>\n",
" <td>1/1:0,2:2:6:76,6,0</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" </tr>\n",
" <tr>\n",
" <th>16</th>\n",
" <td>34</td>\n",
" <td>1</td>\n",
" <td>866511</td>\n",
" <td>rs60722469</td>\n",
" <td>C</td>\n",
" <td>CCCCT</td>\n",
" <td>325.15</td>\n",
" <td>PASS</td>\n",
" <td>AC=6;AF=0.750;AN=8;BaseQRankSum=0.747;DB;DP=15...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:5,5:10:15:278,15,0</td>\n",
" <td>1/1:3,0:3:3:32,3,0</td>\n",
" <td>0/0:1,0:1:3:0,3,65</td>\n",
" <td>1/1:0,1:1:3:67,3,0</td>\n",
" <td>CCCCT-CCCCT</td>\n",
" <td>CCCCT-CCCCT</td>\n",
" <td>C-C</td>\n",
" <td>CCCCT-CCCCT</td>\n",
" </tr>\n",
" <tr>\n",
" <th>17</th>\n",
" <td>35</td>\n",
" <td>1</td>\n",
" <td>866920</td>\n",
" <td>rs2341361</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>47.01</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=4;AF=1.00;AN=4;DB;DP=2;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>18</th>\n",
" <td>36</td>\n",
" <td>1</td>\n",
" <td>867584</td>\n",
" <td>rs2341360</td>\n",
" <td>A</td>\n",
" <td>T</td>\n",
" <td>47.01</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=4;AF=1.00;AN=4;DB;DP=2;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>T-T</td>\n",
" <td>T-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>19</th>\n",
" <td>37</td>\n",
" <td>1</td>\n",
" <td>869323</td>\n",
" <td>rs13303207</td>\n",
" <td>T</td>\n",
" <td>C</td>\n",
" <td>69.22</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=4;AF=1.00;AN=4;DB;DP=3;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,2:2:6:73,6,0</td>\n",
" <td>1/1:0,1:1:3:30,3,0</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" </tr>\n",
" <tr>\n",
" <th>20</th>\n",
" <td>40</td>\n",
" <td>1</td>\n",
" <td>870903</td>\n",
" <td>rs13303094</td>\n",
" <td>T</td>\n",
" <td>C</td>\n",
" <td>183.66</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=6;AF=1.00;AN=6;DB;DP=6;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,2:2:6:62,6,0</td>\n",
" <td>1/1:0,2:2:6:79,6,0</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,2:2:6:79,6,0</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" <td>-</td>\n",
" <td>C-C</td>\n",
" </tr>\n",
" <tr>\n",
" <th>21</th>\n",
" <td>41</td>\n",
" <td>1</td>\n",
" <td>871334</td>\n",
" <td>rs4072383</td>\n",
" <td>G</td>\n",
" <td>T</td>\n",
" <td>74.01</td>\n",
" <td>PASS</td>\n",
" <td>ABHet=0.500;ABHom=1.00;AC=3;AF=0.500;AN=6;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,2:2:6:63,6,0</td>\n",
" <td>0/0:3,0:3:9:0,9,120</td>\n",
" <td>0/1:2,2:4:52:52,0,68</td>\n",
" <td>-</td>\n",
" <td>T-T</td>\n",
" <td>G-G</td>\n",
" <td>G-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>22</th>\n",
" <td>42</td>\n",
" <td>1</td>\n",
" <td>873558</td>\n",
" <td>rs1110052</td>\n",
" <td>G</td>\n",
" <td>T</td>\n",
" <td>39.01</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=4;AF=1.00;AN=4;DB;DP=2;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,1:1:3:39,3,0</td>\n",
" <td>1/1:0,1:1:3:33,3,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>T-T</td>\n",
" <td>T-T</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>23</th>\n",
" <td>43</td>\n",
" <td>1</td>\n",
" <td>876499</td>\n",
" <td>rs4372192</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>200.89</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=4;AF=1.00;AN=4;DB;DP=6;Dels=0.00...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,4:4:12:160,12,0</td>\n",
" <td>1/1:0,2:2:6:76,6,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" </tr>\n",
" <tr>\n",
" <th>24</th>\n",
" <td>44</td>\n",
" <td>1</td>\n",
" <td>878784</td>\n",
" <td>rs142929357</td>\n",
" <td>C</td>\n",
" <td>G</td>\n",
" <td>125.24</td>\n",
" <td>PASS</td>\n",
" <td>ABHet=0.583;ABHom=1.00;AC=2;AF=0.250;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/0:16,0:16:45:0,45,553</td>\n",
" <td>0/1:4,4:8:99:136,0,113</td>\n",
" <td>0/1:2,1:3:30:30,0,57</td>\n",
" <td>0/0:2,0:2:6:0,6,66</td>\n",
" <td>C-C</td>\n",
" <td>C-G</td>\n",
" <td>C-G</td>\n",
" <td>C-C</td>\n",
" </tr>\n",
" <tr>\n",
" <th>25</th>\n",
" <td>45</td>\n",
" <td>1</td>\n",
" <td>879317</td>\n",
" <td>rs7523549</td>\n",
" <td>C</td>\n",
" <td>T</td>\n",
" <td>388.57</td>\n",
" <td>PASS</td>\n",
" <td>ABHet=0.493;ABHom=1.00;AC=2;AF=0.250;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:15,8:23:99:243,0,369</td>\n",
" <td>0/0:7,0:7:21:0,21,252</td>\n",
" <td>0/0:12,0:12:36:0,36,405</td>\n",
" <td>0/1:3,6:9:64:187,0,64</td>\n",
" <td>C-T</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" <td>C-T</td>\n",
" </tr>\n",
" <tr>\n",
" <th>26</th>\n",
" <td>46</td>\n",
" <td>1</td>\n",
" <td>879482</td>\n",
" <td>rs149880798</td>\n",
" <td>G</td>\n",
" <td>C</td>\n",
" <td>799.55</td>\n",
" <td>PASS</td>\n",
" <td>ABHet=0.592;ABHom=1.00;AC=2;AF=0.250;AN=8;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:27,20:47:99:584,0,841</td>\n",
" <td>0/0:33,0:33:93:0,93,1155</td>\n",
" <td>0/0:19,0:19:51:0,51,650</td>\n",
" <td>0/1:14,9:23:99:257,0,389</td>\n",
" <td>G-C</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-C</td>\n",
" </tr>\n",
" <tr>\n",
" <th>27</th>\n",
" <td>47</td>\n",
" <td>1</td>\n",
" <td>879676</td>\n",
" <td>rs6605067</td>\n",
" <td>G</td>\n",
" <td>A</td>\n",
" <td>432.72</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=12;Dels=0.0...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,2:2:6:73,6,0</td>\n",
" <td>1/1:0,3:3:9:120,9,0</td>\n",
" <td>1/1:0,3:3:9:120,9,0</td>\n",
" <td>1/1:0,4:4:12:158,12,0</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" <td>A-A</td>\n",
" </tr>\n",
" <tr>\n",
" <th>28</th>\n",
" <td>48</td>\n",
" <td>1</td>\n",
" <td>879687</td>\n",
" <td>rs2839</td>\n",
" <td>T</td>\n",
" <td>C</td>\n",
" <td>335.22</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=10;Dels=0.0...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" <td>1/1:0,3:3:9:114,9,0</td>\n",
" <td>1/1:0,2:2:6:80,6,0</td>\n",
" <td>1/1:0,4:4:12:139,12,0</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" <td>C-C</td>\n",
" </tr>\n",
" <tr>\n",
" <th>29</th>\n",
" <td>49</td>\n",
" <td>1</td>\n",
" <td>880238</td>\n",
" <td>rs3748592</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>516.84</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=8;AF=1.00;AN=8;DB;DP=14;Dels=0.0...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" <td>1/1:0,5:5:15:199,15,0</td>\n",
" <td>1/1:0,3:3:9:120,9,0</td>\n",
" <td>1/1:0,5:5:15:196,15,0</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>...</th>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" <td>...</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268071</th>\n",
" <td>299643</td>\n",
" <td>GL000225.1</td>\n",
" <td>64237</td>\n",
" <td>.</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>152.14</td>\n",
" <td>PASS</td>\n",
" <td>ABHom=1.00;AC=6;AF=1.00;AN=6;DP=5;Dels=0.00;FS...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,2:2:6:70,6,0</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,1:1:3:40,3,0</td>\n",
" <td>1/1:0,2:2:6:78,6,0</td>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268072</th>\n",
" <td>299706</td>\n",
" <td>GL000225.1</td>\n",
" <td>67508</td>\n",
" <td>.</td>\n",
" <td>GT</td>\n",
" <td>G</td>\n",
" <td>229.23</td>\n",
" <td>PASS</td>\n",
" <td>AC=5;AF=0.833;AN=6;BaseQRankSum=-0.742;DP=13;F...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>0/1:1,6:4:40:136,0,40</td>\n",
" <td>1/1:1,1:2:3:47,3,0</td>\n",
" <td>./.</td>\n",
" <td>1/1:0,4:2:6:94,6,0</td>\n",
" <td>GT-G</td>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>G-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268073</th>\n",
" <td>299713</td>\n",
" <td>GL000225.1</td>\n",
" <td>71934</td>\n",
" <td>.</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>62.01</td>\n",
" <td>PASS</td>\n",
" <td>ABHet=0.500;ABHom=1.00;AC=3;AF=0.750;AN=4;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,2:2:6:70,6,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>0/1:1,1:2:28:28,0,33</td>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>A-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268074</th>\n",
" <td>299714</td>\n",
" <td>GL000225.1</td>\n",
" <td>71966</td>\n",
" <td>.</td>\n",
" <td>A</td>\n",
" <td>G</td>\n",
" <td>138.21</td>\n",
" <td>PASS</td>\n",
" <td>ABHet=0.333;ABHom=1.00;AC=3;AF=0.750;AN=4;Base...</td>\n",
" <td>GT:AD:DP:GQ:PL</td>\n",
" <td>1/1:0,3:3:9:113,9,0</td>\n",
" <td>./.</td>\n",
" <td>./.</td>\n",
" <td>0/1:1,2:3:30:62,0,30</td>\n",
" <td>G-G</td>\n",
" <td>-</td>\n",
" <td>-</td>\n",
" <td>A-G</td>\n",
" </tr>\n",
" <tr>\n",
" <th>268075</th>\n",
" <td>299715</td>\n",
" <td>GL000225.1</td>\n",
" <td>72003</td>\n",
" <td>.</td>\n",
" <td>T</td>\n",
" <td>C</td>\n",
" <td>119.76</td>\n",