idt complexity

client.py

>>> from client import *
>>> get_idt_complexity(BAD_DNA_SEQ)
Traceback (most recent call last):
  File "<stdin>", line 1, in <module>
TypeError: get_idt_complexity() missing 1 required positional argument: 'seq'
>>> with requests.Session() as session:
...     session.post(LOGIN_URL, data={FORM_FIELD_USER: USERNAME, FORM_FIELD_PASS: PASSWORD})
...     get_idt_complexity(session, BAD_DNA_SEQ)
...
<Response [200]>
IDT complexity: 169.7
[{'ComplexityColor': 'red', 'ComplexityDetail': 'The identified complexities prevent manufacturing of this sequence. Click Edit for more information.', 'ComplexityLimitReached': True, 'ComplexityScore': 169.7, 'ComplexitySummary': 'Denied - High Complexity (Scores
of 10 or greater)', 'Errors': [{'Id': None, 'Type': 0, 'Text': 'The oligo length of 84 is not allowed for the product you have selected. It must be 125 or more bases and 500 or fewer bases in length for this scale. Adjusting your scale will allow you to order oligo
s of a different length.', 'Rank': 0, 'IsHardError': True, 'RuleDetail': None, 'Actions': []}, {'Id': None, 'Type': 2, 'Text': 'One or more repeated sequences greater than 8 bases comprise 100% of the overall sequence. Solution: Redesign to reduce the repeats to be
 less than 40% of the sequence.', 'Rank': 24, 'IsHardError': False, 'RuleDetail': None, 'Actions': []}, {'Id': None, 'Type': 2, 'Text': 'A repeat with the sequence GGATGGCGATGTGAGGATGGCGATGTGAGGATGGCGATGTGAGGATGGCGATGTGAGGATGGCGATGTGA exists at the following locati
ons: 15, 1. Solution: Modify the sequence to reduce the length of these repeats to less than 11 bases.', 'Rank': 41.3, 'IsHardError': False, 'RuleDetail': None, 'Actions': []}, {'Id': None, 'Type': 2, 'Text': 'The repeated sequence GGATGGCGATGTGAGGATGGCGATGTGAGGATG
GCGATGTGA constitutes 168 bases of the overall sequence. Solution: Redesign to reduce the overall length of this repeat to be below 80 bases.', 'Rank': 26.4, 'IsHardError': False, 'RuleDetail': None, 'Actions': []}, {'Id': None, 'Type': 2, 'Text': 'The repeated seq
uence GGATGGCGATGTGA constitutes 100% of the overall sequence. Solution: Redesign to reduce the overall repeat percentage to be below 15%.', 'Rank': 19, 'IsHardError': False, 'RuleDetail': None, 'Actions': []}, {'Id': None, 'Type': 2, 'Text': 'Greater than 90% of t
he bases within a 70 base window starting at position 1 are part of repeats more than 8 bases long within the entire sequence. Solution: Redesign to reduce or eliminate the density of repeats within this window.', 'Rank': 11, 'IsHardError': False, 'RuleDetail': Non
e, 'Actions': []}, {'Id': None, 'Type': 2, 'Text': 'A repeat with the sequence GGATGGCGATGTGAGGATGGCGATGTGA exists at the following locations: 1,29. Solution: Modify the sequence to reduce the length of these repeats to less than 14 bases.', 'Rank': 28, 'IsHardErro
r': False, 'RuleDetail': None, 'Actions': []}, {'Id': None, 'Type': 2, 'Text': 'The repeated sequence TGGCGATGTGAGGATGGC exists at the following locations: 4, 18, 32, 46, 60.Solution: Redesign to disrupt instances of the repeat near the terminal end(s) or add extra
 bases to push the repeat internally.', 'Rank': 10, 'IsHardError': False, 'RuleDetail': None, 'Actions': []}, {'Id': None, 'Type': 2, 'Text': 'The repeated sequence GCGATGTGAGGATGGCGATG exists at the following locations: 6, 20, 34, 48, 62.Solution: Redesign to disr
upt instances of the repeat near the terminal end(s) or add extra bases to push the repeat internally.', 'Rank': 10, 'IsHardError': False, 'RuleDetail': None, 'Actions': []}], 'HasPhos': False, 'Name': 'test', 'OligoNumber': -1, 'ProductId': 5038, 'Sequence': 'GGAT
GGCGATGTGAGGATGGCGATGTGAGGATGGCGATGTGAGGATGGCGATGTGAGGATGGCGATGTGAGGATGGCGATGTGA'}]