I hereby claim:
- I am afrendeiro on github.
- I am afrendeiro (https://keybase.io/afrendeiro) on keybase.
- I have a public key ASCLj9Mi9QyGyaS_Ez-M1L2daTExlulKnwG2ltgD_v_mNwo
To claim this, I am signing this object:
import os | |
import pandas as pd | |
from argparse import ArgumentParser | |
# Parse command-line arguments | |
parser = ArgumentParser( | |
prog="CSV parser", | |
description="Gets some column out of CSVs." | |
) |
for GENOME in hg19 mm10 danRer10 | |
do | |
# Static files | |
mkdir -p resources/${GENOME} | |
cd resources/${GENOME} | |
### Genome | |
wget http://hgdownload.cse.ucsc.edu/goldenPath/${GENOME}/bigZips/${GENOME}.2bit | |
twoBitToFa ${GENOME}.2bit ${GENOME}.fa | |
samtools faidx ${GENOME}.fa | |
cd ../.. |
# Install zimba | |
R | |
install.packages(c("R.oo")) | |
install.packages(c("R.utils", "quantreg","doParallel","doMC","foreach")) # for R>3.0 | |
# only version that works with R 3.0: | |
# get it from here: https://code.google.com/p/zinba/issues/detail?id=69 | |
install.packages("zinba_2.03.1.tar.gz", repos=NULL) | |
# Make bed files from bams | |
# system("bedtools bamtobed -i /data/mapped/sample.bam > ~/zinba/reads/sample.bed") |
CURRENT_DATE=20181212 | |
NUMBER_MAIN_FIGURES=5 | |
NUMBER_SUPP_FIGURES=11 | |
ROOT_DIR=/home/path/to/paper/figures | |
cd $ROOT_DIR | |
mkdir -p cropped_unlabeled_pngs | |
# Cell Press format convertion |
# Change this | |
CURRENT_DATE=20181212 | |
NUMBER_MAIN_FIGURES=5 | |
NUMBER_SUPP_FIGURES=11 | |
ROOT_DIR=/home/path/to/paper/figures | |
# Don't change this | |
cd $ROOT_DIR | |
mkdir -p cropped_unlabeled_pngs |
def plot_differential_enrichment( | |
enrichment_table, | |
enrichment_type, | |
data_type="ATAC-seq", | |
direction_dependent=True, | |
output_dir="results/differential_analysis_{data_type}/enrichments", | |
comp_variable="comparison_name", | |
output_prefix="differential_analysis", | |
rasterized=True, |
>chr1 | |
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC | |
ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC |
import pandas as pd | |
from sklearn.preprocessing import StandardScaler | |
# get list of genes of interest (e.g. from diff exp, or a known signature) | |
diff = pd.Index(['geneX', 'geneY']) | |
# X is our numeric matrix, shape (n_features, n_samples) | |
X = pd.DataFrame(index=['geneA', 'geneZ'], columns=['stimul_1', 'stimul_2'] + ['unstimul_1', 'unstimul_2']) | |
# Standardize and center |
import scanpy.api as sc | |
import numpy as np | |
def add_tracker(field_name="tracker"): | |
from inspect import getcallargs | |
from functools import wraps | |
def tracker(f): | |
@wraps(f) | |
def wrapper(*args, **kwds): |
I hereby claim:
To claim this, I am signing this object: