Skip to content

Instantly share code, notes, and snippets.

@dcjones
Created April 3, 2012 02:22
Show Gist options
  • Save dcjones/2288846 to your computer and use it in GitHub Desktop.
Save dcjones/2288846 to your computer and use it in GitHub Desktop.
The fasta benchmark in Julia
const line_width = 60
const alu = strcat(
"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG",
"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA",
"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT",
"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA",
"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG",
"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC",
"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")
const iub =
(b"acgtBDHKMNRSVWY",
[0.27, 0.12, 0.12, 0.27, 0.02,
0.02, 0.02, 0.02, 0.02, 0.02,
0.02, 0.02, 0.02, 0.02, 0.02])
const homosapiens =
(b"acgt",
[0.3029549426680, 0.1979883004921,
0.1975473066391, 0.3015094502008])
const IM = 139968
const IA = 3877
const IC = 29573
const IMf = float64(IM)
rng_state = 42
function gen_random(max::Float64)
global rng_state = (rng_state * IA + IC) % IM
max * float(rng_state) / IMf
end
function repeat_fasta(src, n)
k = length(src)
s = strcat(src, src, src[1:n % k])
for j = 0:div(n, line_width) - 1
i = j * line_width % k
println(s[i + 1:i + line_width])
end
if n % line_width > 0
println(s[end - (n % line_width) + 1:])
end
end
function choose_char(cs)
k = length(cs)
r = gen_random(1.0)
if r < cs[1]; return 1; end
a::Uint = 1
b::Uint = k
while b > a + 1
c = div(a + b, 2)
if r < cs[c]; b = c; else a = c; end
end
b
end
function random_fasta(symb, pr, n)
cs = cumsum(pr)
line = Array(Uint8, line_width)
k = n
while k > 0
m = min(k, line_width)
for i = 1:m
line[i] = symb[choose_char(cs)]
end
println(line[1:m])
k -= line_width
end
end
const n = int(ARGS[1])
println(">ONE Homo sapiens alu")
repeat_fasta(alu, 2n)
println(">TWO IUB ambiguity codes")
random_fasta(iub[1], iub[2], 3n)
println(">THREE Homo sapiens frequency")
random_fasta(homosapiens[1], homosapiens[2], 5n)
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment