Skip to content

Instantly share code, notes, and snippets.

@dfornika
dfornika / Singularity
Created February 15, 2019 20:51
Singularity file for MentaLiST
Bootstrap: docker
from: ubuntu:18.04
%environment
JULIA_PKGDIR="/opt/.julia"
export JULIA_PKGDIR
%post
apt-get update
apt-get install -y ca-certificates wget hdf5-tools
@dfornika
dfornika / intro.md
Created February 10, 2019 18:16 — forked from derhuerst/intro.md
Installing Git on Linux, Mac OS X and Windows
import re
import Bio.Data.IUPACData
sequence = "GCATGCATCTATACGTAGCTATACTACGATCTACGATCGATCGATGCTATGCATCATGACTACTATGCATCATAGCTGCAT"
pattern = "TATACGTAGCTATACTN{0,100}ATCTACGATCGATCGATGCN{0,100}ACTACTATGCATCATAG"
def nt_search_regex(seq, subseq):
"""Search for a DNA subseq in sequence.
#!/bin/bash
# You can place qsub command line parameters (settings) here.
# -V Specifies that all environment variables active within the qsub utility
# be exported to the context of the job: $ -V
# -cwd enables current working directory (where you typed qsub) to be the folder that job log files are saved: $ -cwd
# Indicate number of processors to use: $ -pe mpi 5
# Send status information to this email address: $ -M $USER
# Send an e-mail when the job is done: $ -m e
echo "hello from job script!"
@dfornika
dfornika / # libiconv - 2016-06-06_17-20-48.txt
Created June 6, 2016 17:41
libiconv (homebrew/dupes/libiconv) on "CentOS release 6.6 (Final)" - Homebrew build logs
Homebrew build logs for homebrew/dupes/libiconv on "CentOS release 6.6 (Final)"
Build date: 2016-06-06 17:20:48
@dfornika
dfornika / # blast - 2016-02-29_23-01-08.txt
Created March 1, 2016 00:14
blast (homebrew/science/blast) on x86_64-linux - Homebrew build logs
Homebrew build logs for homebrew/science/blast on x86_64-linux
Build date: 2016-02-29 23:01:08
@dfornika
dfornika / # llvm - 2016-02-24_19-14-31.txt
Created February 24, 2016 19:28
llvm on x86_64-linux - Homebrew build logs
Homebrew build logs for llvm on x86_64-linux
Build date: 2016-02-24 19:14:31
@dfornika
dfornika / # rust - 2016-02-19_23-08-06.txt
Created February 19, 2016 23:17
rust on x86_64-linux - Homebrew build logs
Homebrew build logs for rust on x86_64-linux
Build date: 2016-02-19 23:08:06
@dfornika
dfornika / # rstudio-server - 2016-02-19_20-18-18.txt
Created February 19, 2016 20:24
rstudio-server (homebrew/science/rstudio-server) on x86_64-linux - Homebrew build logs
Homebrew build logs for homebrew/science/rstudio-server on x86_64-linux
Build date: 2016-02-19 20:18:18
@dfornika
dfornika / # rstudio-server - 2016-02-19_19-34-41.txt
Created February 19, 2016 19:37
rstudio-server (homebrew/science/rstudio-server) on x86_64-linux - Homebrew build logs
Homebrew build logs for homebrew/science/rstudio-server on x86_64-linux
Build date: 2016-02-19 19:34:41