Dan Fornika dfornika

## Singularity
Bootstrap: docker
from: ubuntu:18.04

%environment
    JULIA_PKGDIR="/opt/.julia"
    export JULIA_PKGDIR

%post
    apt-get update
    apt-get install -y ca-certificates wget hdf5-tools

## intro.md

      
              4 files
            
          
              0 forks
            
          
                0 comments
              
            
              0 stars
            
          
                dfornika
                / intro.md
            
            
              Created
              February 10, 2019 18:16
                — forked from derhuerst/intro.md
            
              
                Installing Git on Linux, Mac OS X and Windows
              
          
    Installing Git – the easy way


Git is a free and open source distributed version control system designed to handle everything from small to very large projects with speed and efficiency.

– The Git website
Choose one of the following options.

Instructions for Windows
Instructions for Mac
Instructions for Linux


## nt_search_regex.py
import re
import Bio.Data.IUPACData

sequence = "GCATGCATCTATACGTAGCTATACTACGATCTACGATCGATCGATGCTATGCATCATGACTACTATGCATCATAGCTGCAT"

pattern = "TATACGTAGCTATACTN{0,100}ATCTACGATCGATCGATGCN{0,100}ACTACTATGCATCATAG"

def nt_search_regex(seq, subseq):
    """Search for a DNA subseq in sequence.


## qsub_test.sh
#!/bin/bash
# You can place qsub command line parameters (settings) here.
#     -V Specifies that all environment variables active within the qsub utility
#     be exported to the context of the job: $ -V
#     -cwd enables current working directory (where you typed qsub) to be the folder that job log files are saved: $ -cwd
#     Indicate number of processors to use: $ -pe mpi 5
#     Send status information to this email address: $ -M $USER
#     Send an e-mail when the job is done: $ -m e

echo "hello from job script!"

## # libiconv - 2016-06-06_17-20-48.txt
Homebrew build logs for homebrew/dupes/libiconv on "CentOS release 6.6 (Final)"
Build date: 2016-06-06 17:20:48

## # blast - 2016-02-29_23-01-08.txt
Homebrew build logs for homebrew/science/blast on x86_64-linux
Build date: 2016-02-29 23:01:08

## # llvm - 2016-02-24_19-14-31.txt
Homebrew build logs for llvm on x86_64-linux
Build date: 2016-02-24 19:14:31

## # rust - 2016-02-19_23-08-06.txt
Homebrew build logs for rust on x86_64-linux
Build date: 2016-02-19 23:08:06

## # rstudio-server - 2016-02-19_20-18-18.txt
Homebrew build logs for homebrew/science/rstudio-server on x86_64-linux
Build date: 2016-02-19 20:18:18

## # rstudio-server - 2016-02-19_19-34-41.txt
Homebrew build logs for homebrew/science/rstudio-server on x86_64-linux
Build date: 2016-02-19 19:34:41
	Bootstrap: docker
	from: ubuntu:18.04

	%environment
	JULIA_PKGDIR="/opt/.julia"
	export JULIA_PKGDIR

	%post
	apt-get update
	apt-get install -y ca-certificates wget hdf5-tools
	import re
	import Bio.Data.IUPACData

	sequence = "GCATGCATCTATACGTAGCTATACTACGATCTACGATCGATCGATGCTATGCATCATGACTACTATGCATCATAGCTGCAT"

	pattern = "TATACGTAGCTATACTN{0,100}ATCTACGATCGATCGATGCN{0,100}ACTACTATGCATCATAG"

	def nt_search_regex(seq, subseq):
	"""Search for a DNA subseq in sequence.
	#!/bin/bash
	# You can place qsub command line parameters (settings) here.
	# -V Specifies that all environment variables active within the qsub utility
	# be exported to the context of the job: $ -V
	# -cwd enables current working directory (where you typed qsub) to be the folder that job log files are saved: $ -cwd
	# Indicate number of processors to use: $ -pe mpi 5
	# Send status information to this email address: $ -M $USER
	# Send an e-mail when the job is done: $ -m e

	echo "hello from job script!"
	Homebrew build logs for homebrew/dupes/libiconv on "CentOS release 6.6 (Final)"
	Build date: 2016-06-06 17:20:48
	Homebrew build logs for homebrew/science/blast on x86_64-linux
	Build date: 2016-02-29 23:01:08
	Homebrew build logs for llvm on x86_64-linux
	Build date: 2016-02-24 19:14:31
	Homebrew build logs for rust on x86_64-linux
	Build date: 2016-02-19 23:08:06
	Homebrew build logs for homebrew/science/rstudio-server on x86_64-linux
	Build date: 2016-02-19 20:18:18
	Homebrew build logs for homebrew/science/rstudio-server on x86_64-linux
	Build date: 2016-02-19 19:34:41