Skip to content

Instantly share code, notes, and snippets.

David Powell drpowell

Block or report user

Report or block drpowell

Hide content and notifications from this user.

Learn more about blocking users

Contact Support about this user’s behavior.

Learn more about reporting abuse

Report abuse
View GitHub Profile
@drpowell
drpowell / counts2.csv
Created Oct 30, 2017
problem with glmQLFTest()
View counts2.csv
Feature cdhR-rep1 cdhR-rep2 GppX-rep1 GppX-rep2 luxS-rep1 luxS-rep2 luxS-rep3 wt-rep1 wt-rep2 wt-rep3 Length gene product
PG_0001 491 258 198 442 480 737 651 336 633 286 1422 dnaA chromosomal replication initiator protein DnaA
PG_0002 69 54 45 86 84 72 119 92 94 63 573 hexapeptide transferase family protein
PG_0003 107 45 54 62 47 93 76 72 86 26 1020 membrane protein, putative
PG_0004 145 70 100 45 141 170 85 99 232 95 705 transcriptional regulator, Sir2 family
PG_0005 276 172 104 233 189 475 277 181 269 115 1155 conserved hypothetical protein
PG_0006 140 92 84 118 85 186 169 89 161 47 1329 MATE efflux family protein
PG_0007 10 0 5 0 4 2 0 7 1 0 159 hypothetical protein
PG_0008 0 0 0 0 0 0 0 0 0 0 939 ISPg5 transposase Orf2
PG_0009 0 0 0 0 0 0 0 0 0 0 390 ISPg5 transposase Orf1
@drpowell
drpowell / gist:cc679ceea709dfa3af79
Created Jul 18, 2014
Add blastn as a chrome search engine
View gist:cc679ceea709dfa3af79
This allows you to use simple blast search from your chrome location bar. eg. type "bn AGGTTGTATAGTTTGGGGCTCT"
Right-click in the chrome location bar, select "Edit Search Engines"
Scroll to the bottom
- Enter a name, say "blastn"
- Enter a keyword, say "bn"
- Cut-and-paste the snippit below into the URL
https://blast.ncbi.nlm.nih.gov/Blast.cgi?QUERY=%s&db=nucleotide&QUERY_FROM=&QUERY_TO=&QUERYFILE=&GENETIC_CODE=1&JOB_TITLE=&SUBJECTS=&stype=nucleotide&SUBJECTS_FROM=&SUBJECTS_TO=&SUBJECTFILE=&DBTYPE=gc&DATABASE=nr&EQ_MENU=&NUM_ORG=1&EQ_TEXT=&BLAST_PROGRAMS=megaBlast&PHI_PATTERN=&MAX_NUM_SEQ=100&SHORT_QUERY_ADJUST=on&EXPECT=10&WORD_SIZE=28&HSP_RANGE_MAX=0&MATRIX_NAME=PAM30&MATCH_SCORES=1,-2&GAPCOSTS=0 0&COMPOSITION_BASED_STATISTICS=0&FILTER=L&REPEATS=5755&FILTER=m&TEMPLATE_LENGTH=0&TEMPLATE_TYPE=0&PSSM=&I_THRESH=&DI_THRESH=&PSI_PSEUDOCOUNT=&SHOW_OVERVIEW=true&SHOW_LINKOUT=true&GET_SEQUENCE=true&FORMAT_OBJECT=Alignment&FORMAT_TYPE=HTML&ALIGNMENT_VIEW=Pairwise&MASK_CHAR=2&MASK_COLOR=1&DESCRIPTIONS=100&A
@drpowell
drpowell / pin-cpu.c
Created Jun 25, 2012
Trivial program to max a single CPU core
View pin-cpu.c
main()
{
float t=1;
while(t!=0) {
t+=2;
}
}
@drpowell
drpowell / gist:1005798
Created Jun 3, 2011
Tom's coding challenge
View gist:1005798
module Library
def self.leaf_paths_of(paths)
normalized = paths.map {|s| x=s.squeeze('/'); x+='/'}
leafs = normalized.reject { |x| normalized.any? { |a| x != a && a.start_with?(x) } }
leafs.map {|x| x.chomp('/') }.uniq
end
end
View FmtLogHandler.hs
module FmtLogHandler
(fmtLogHandler
,logFormatter
) where
import System.Log.Logger
import System.Log
import System.Log.Handler
import System.IO
You can’t perform that action at this time.